ID: 1001539298

View in Genome Browser
Species Human (GRCh38)
Location 5:172526223-172526245
Sequence TCGGTGGCTGCTCTGCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001539292_1001539298 19 Left 1001539292 5:172526181-172526203 CCTGTGGTCCTCTCTGCGTGGCT No data
Right 1001539298 5:172526223-172526245 TCGGTGGCTGCTCTGCTCCCTGG No data
1001539289_1001539298 25 Left 1001539289 5:172526175-172526197 CCCGGTCCTGTGGTCCTCTCTGC No data
Right 1001539298 5:172526223-172526245 TCGGTGGCTGCTCTGCTCCCTGG No data
1001539293_1001539298 11 Left 1001539293 5:172526189-172526211 CCTCTCTGCGTGGCTGAGAACTC No data
Right 1001539298 5:172526223-172526245 TCGGTGGCTGCTCTGCTCCCTGG No data
1001539290_1001539298 24 Left 1001539290 5:172526176-172526198 CCGGTCCTGTGGTCCTCTCTGCG No data
Right 1001539298 5:172526223-172526245 TCGGTGGCTGCTCTGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001539298 Original CRISPR TCGGTGGCTGCTCTGCTCCC TGG Intergenic