ID: 1001539299

View in Genome Browser
Species Human (GRCh38)
Location 5:172526232-172526254
Sequence GCTCTGCTCCCTGGTAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001539292_1001539299 28 Left 1001539292 5:172526181-172526203 CCTGTGGTCCTCTCTGCGTGGCT No data
Right 1001539299 5:172526232-172526254 GCTCTGCTCCCTGGTAGTGAAGG No data
1001539293_1001539299 20 Left 1001539293 5:172526189-172526211 CCTCTCTGCGTGGCTGAGAACTC No data
Right 1001539299 5:172526232-172526254 GCTCTGCTCCCTGGTAGTGAAGG No data
1001539296_1001539299 -4 Left 1001539296 5:172526213-172526235 CCTGTCTTCCTCGGTGGCTGCTC No data
Right 1001539299 5:172526232-172526254 GCTCTGCTCCCTGGTAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001539299 Original CRISPR GCTCTGCTCCCTGGTAGTGA AGG Intergenic