ID: 1001539303

View in Genome Browser
Species Human (GRCh38)
Location 5:172526241-172526263
Sequence CCCCTGATTCCTTCACTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001539303_1001539307 -7 Left 1001539303 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG No data
Right 1001539307 5:172526257-172526279 TCAGGGGTGTGTTCCCGCTGGGG No data
1001539303_1001539305 -9 Left 1001539303 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG No data
Right 1001539305 5:172526255-172526277 AATCAGGGGTGTGTTCCCGCTGG No data
1001539303_1001539306 -8 Left 1001539303 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG No data
Right 1001539306 5:172526256-172526278 ATCAGGGGTGTGTTCCCGCTGGG No data
1001539303_1001539310 9 Left 1001539303 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG No data
Right 1001539310 5:172526273-172526295 GCTGGGGCCACCTCTGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001539303 Original CRISPR CCCCTGATTCCTTCACTACC AGG (reversed) Intergenic
No off target data available for this crispr