ID: 1001539304

View in Genome Browser
Species Human (GRCh38)
Location 5:172526241-172526263
Sequence CCTGGTAGTGAAGGAATCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001539296_1001539304 5 Left 1001539296 5:172526213-172526235 CCTGTCTTCCTCGGTGGCTGCTC No data
Right 1001539304 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG No data
1001539293_1001539304 29 Left 1001539293 5:172526189-172526211 CCTCTCTGCGTGGCTGAGAACTC No data
Right 1001539304 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG No data
1001539297_1001539304 -3 Left 1001539297 5:172526221-172526243 CCTCGGTGGCTGCTCTGCTCCCT No data
Right 1001539304 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001539304 Original CRISPR CCTGGTAGTGAAGGAATCAG GGG Intergenic