ID: 1001539305

View in Genome Browser
Species Human (GRCh38)
Location 5:172526255-172526277
Sequence AATCAGGGGTGTGTTCCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001539297_1001539305 11 Left 1001539297 5:172526221-172526243 CCTCGGTGGCTGCTCTGCTCCCT No data
Right 1001539305 5:172526255-172526277 AATCAGGGGTGTGTTCCCGCTGG No data
1001539296_1001539305 19 Left 1001539296 5:172526213-172526235 CCTGTCTTCCTCGGTGGCTGCTC No data
Right 1001539305 5:172526255-172526277 AATCAGGGGTGTGTTCCCGCTGG No data
1001539303_1001539305 -9 Left 1001539303 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG No data
Right 1001539305 5:172526255-172526277 AATCAGGGGTGTGTTCCCGCTGG No data
1001539301_1001539305 -8 Left 1001539301 5:172526240-172526262 CCCTGGTAGTGAAGGAATCAGGG No data
Right 1001539305 5:172526255-172526277 AATCAGGGGTGTGTTCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001539305 Original CRISPR AATCAGGGGTGTGTTCCCGC TGG Intergenic
No off target data available for this crispr