ID: 1001539310

View in Genome Browser
Species Human (GRCh38)
Location 5:172526273-172526295
Sequence GCTGGGGCCACCTCTGTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001539303_1001539310 9 Left 1001539303 5:172526241-172526263 CCTGGTAGTGAAGGAATCAGGGG No data
Right 1001539310 5:172526273-172526295 GCTGGGGCCACCTCTGTCTATGG No data
1001539297_1001539310 29 Left 1001539297 5:172526221-172526243 CCTCGGTGGCTGCTCTGCTCCCT No data
Right 1001539310 5:172526273-172526295 GCTGGGGCCACCTCTGTCTATGG No data
1001539301_1001539310 10 Left 1001539301 5:172526240-172526262 CCCTGGTAGTGAAGGAATCAGGG No data
Right 1001539310 5:172526273-172526295 GCTGGGGCCACCTCTGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001539310 Original CRISPR GCTGGGGCCACCTCTGTCTA TGG Intergenic
No off target data available for this crispr