ID: 1001541388

View in Genome Browser
Species Human (GRCh38)
Location 5:172542360-172542382
Sequence CTTTCCTCATTCATGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001541386_1001541388 3 Left 1001541386 5:172542334-172542356 CCGTCAGATTACTTCTCTGAGTT No data
Right 1001541388 5:172542360-172542382 CTTTCCTCATTCATGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001541388 Original CRISPR CTTTCCTCATTCATGGAACA AGG Intergenic
No off target data available for this crispr