ID: 1001542359

View in Genome Browser
Species Human (GRCh38)
Location 5:172548490-172548512
Sequence TTTATTAGTGGCCCACAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001542359_1001542362 28 Left 1001542359 5:172548490-172548512 CCTGATTGTGGGCCACTAATAAA No data
Right 1001542362 5:172548541-172548563 TTGAATTCCCAAGTCTTCCATGG No data
1001542359_1001542361 -10 Left 1001542359 5:172548490-172548512 CCTGATTGTGGGCCACTAATAAA No data
Right 1001542361 5:172548503-172548525 CACTAATAAATGCATCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001542359 Original CRISPR TTTATTAGTGGCCCACAATC AGG (reversed) Intergenic
No off target data available for this crispr