ID: 1001542513

View in Genome Browser
Species Human (GRCh38)
Location 5:172549531-172549553
Sequence GACTCAGGCTTTGTCCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001542508_1001542513 3 Left 1001542508 5:172549505-172549527 CCTTCACTGAGTTCTGCGTGGAG No data
Right 1001542513 5:172549531-172549553 GACTCAGGCTTTGTCCGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001542513 Original CRISPR GACTCAGGCTTTGTCCGGGA AGG Intergenic
No off target data available for this crispr