ID: 1001543069

View in Genome Browser
Species Human (GRCh38)
Location 5:172552609-172552631
Sequence CCTGGAGGGCACACACAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001543060_1001543069 -7 Left 1001543060 5:172552593-172552615 CCCCCAGCCTCGTCCTCCTGGAG No data
Right 1001543069 5:172552609-172552631 CCTGGAGGGCACACACAGTCTGG No data
1001543065_1001543069 -10 Left 1001543065 5:172552596-172552618 CCAGCCTCGTCCTCCTGGAGGGC No data
Right 1001543069 5:172552609-172552631 CCTGGAGGGCACACACAGTCTGG No data
1001543063_1001543069 -9 Left 1001543063 5:172552595-172552617 CCCAGCCTCGTCCTCCTGGAGGG No data
Right 1001543069 5:172552609-172552631 CCTGGAGGGCACACACAGTCTGG No data
1001543061_1001543069 -8 Left 1001543061 5:172552594-172552616 CCCCAGCCTCGTCCTCCTGGAGG No data
Right 1001543069 5:172552609-172552631 CCTGGAGGGCACACACAGTCTGG No data
1001543057_1001543069 28 Left 1001543057 5:172552558-172552580 CCTGGTTGATGGGTGCTGGGTCA No data
Right 1001543069 5:172552609-172552631 CCTGGAGGGCACACACAGTCTGG No data
1001543058_1001543069 -4 Left 1001543058 5:172552590-172552612 CCACCCCCAGCCTCGTCCTCCTG No data
Right 1001543069 5:172552609-172552631 CCTGGAGGGCACACACAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001543069 Original CRISPR CCTGGAGGGCACACACAGTC TGG Intergenic
No off target data available for this crispr