ID: 1001543905

View in Genome Browser
Species Human (GRCh38)
Location 5:172558373-172558395
Sequence AGGCACGGCCCAGAACGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001543901_1001543905 10 Left 1001543901 5:172558340-172558362 CCTGGAGGGCTCGTTCTCATCTC No data
Right 1001543905 5:172558373-172558395 AGGCACGGCCCAGAACGTGCAGG No data
1001543900_1001543905 13 Left 1001543900 5:172558337-172558359 CCTCCTGGAGGGCTCGTTCTCAT No data
Right 1001543905 5:172558373-172558395 AGGCACGGCCCAGAACGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001543905 Original CRISPR AGGCACGGCCCAGAACGTGC AGG Intergenic
No off target data available for this crispr