ID: 1001544391

View in Genome Browser
Species Human (GRCh38)
Location 5:172561710-172561732
Sequence GTTACTTATGTGTTCAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001544388_1001544391 4 Left 1001544388 5:172561683-172561705 CCTCAGCTTAACTGATCACAGCT No data
Right 1001544391 5:172561710-172561732 GTTACTTATGTGTTCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001544391 Original CRISPR GTTACTTATGTGTTCAGGGC TGG Intergenic
No off target data available for this crispr