ID: 1001547439

View in Genome Browser
Species Human (GRCh38)
Location 5:172579327-172579349
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001547439_1001547442 10 Left 1001547439 5:172579327-172579349 CCTCCAATTCTGGGTCTGCAGAG No data
Right 1001547442 5:172579360-172579382 ATCAGTCAGCCCTTTCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001547439 Original CRISPR CTCTGCAGACCCAGAATTGG AGG (reversed) Intergenic
No off target data available for this crispr