ID: 1001549549

View in Genome Browser
Species Human (GRCh38)
Location 5:172593313-172593335
Sequence GGGCCTCCTCTCAGCAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001549549_1001549563 20 Left 1001549549 5:172593313-172593335 CCCTGGCTGCTGAGAGGAGGCCC No data
Right 1001549563 5:172593356-172593378 GAGACTATGAGGAGGAGAGTGGG No data
1001549549_1001549557 -3 Left 1001549549 5:172593313-172593335 CCCTGGCTGCTGAGAGGAGGCCC No data
Right 1001549557 5:172593333-172593355 CCCGAGGATGGACTGGAGGGAGG No data
1001549549_1001549553 -10 Left 1001549549 5:172593313-172593335 CCCTGGCTGCTGAGAGGAGGCCC No data
Right 1001549553 5:172593326-172593348 GAGGAGGCCCGAGGATGGACTGG No data
1001549549_1001549555 -6 Left 1001549549 5:172593313-172593335 CCCTGGCTGCTGAGAGGAGGCCC No data
Right 1001549555 5:172593330-172593352 AGGCCCGAGGATGGACTGGAGGG No data
1001549549_1001549565 28 Left 1001549549 5:172593313-172593335 CCCTGGCTGCTGAGAGGAGGCCC No data
Right 1001549565 5:172593364-172593386 GAGGAGGAGAGTGGGATGAAGGG No data
1001549549_1001549561 12 Left 1001549549 5:172593313-172593335 CCCTGGCTGCTGAGAGGAGGCCC No data
Right 1001549561 5:172593348-172593370 GAGGGAGGGAGACTATGAGGAGG No data
1001549549_1001549560 9 Left 1001549549 5:172593313-172593335 CCCTGGCTGCTGAGAGGAGGCCC No data
Right 1001549560 5:172593345-172593367 CTGGAGGGAGGGAGACTATGAGG No data
1001549549_1001549564 27 Left 1001549549 5:172593313-172593335 CCCTGGCTGCTGAGAGGAGGCCC No data
Right 1001549564 5:172593363-172593385 TGAGGAGGAGAGTGGGATGAAGG No data
1001549549_1001549562 19 Left 1001549549 5:172593313-172593335 CCCTGGCTGCTGAGAGGAGGCCC No data
Right 1001549562 5:172593355-172593377 GGAGACTATGAGGAGGAGAGTGG No data
1001549549_1001549559 -2 Left 1001549549 5:172593313-172593335 CCCTGGCTGCTGAGAGGAGGCCC No data
Right 1001549559 5:172593334-172593356 CCGAGGATGGACTGGAGGGAGGG No data
1001549549_1001549554 -7 Left 1001549549 5:172593313-172593335 CCCTGGCTGCTGAGAGGAGGCCC No data
Right 1001549554 5:172593329-172593351 GAGGCCCGAGGATGGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001549549 Original CRISPR GGGCCTCCTCTCAGCAGCCA GGG (reversed) Intergenic
No off target data available for this crispr