ID: 1001550412

View in Genome Browser
Species Human (GRCh38)
Location 5:172598453-172598475
Sequence GGCCAGGGTGATGGCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001550398_1001550412 6 Left 1001550398 5:172598424-172598446 CCAGCCCAGCCAGAAGACAGAGG No data
Right 1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG No data
1001550401_1001550412 2 Left 1001550401 5:172598428-172598450 CCCAGCCAGAAGACAGAGGGTGG No data
Right 1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG No data
1001550408_1001550412 -3 Left 1001550408 5:172598433-172598455 CCAGAAGACAGAGGGTGGGGGGC No data
Right 1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG No data
1001550397_1001550412 19 Left 1001550397 5:172598411-172598433 CCGTCGGCACTGGCCAGCCCAGC No data
Right 1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG No data
1001550396_1001550412 26 Left 1001550396 5:172598404-172598426 CCGAGCTCCGTCGGCACTGGCCA No data
Right 1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG No data
1001550403_1001550412 1 Left 1001550403 5:172598429-172598451 CCAGCCAGAAGACAGAGGGTGGG No data
Right 1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001550412 Original CRISPR GGCCAGGGTGATGGCTCCTG TGG Intergenic
No off target data available for this crispr