ID: 1001556081

View in Genome Browser
Species Human (GRCh38)
Location 5:172638108-172638130
Sequence TCACCCCCATGGCTTCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001556077_1001556081 -9 Left 1001556077 5:172638094-172638116 CCTCAAACCATAAATCACCCCCA No data
Right 1001556081 5:172638108-172638130 TCACCCCCATGGCTTCATGTGGG No data
1001556076_1001556081 8 Left 1001556076 5:172638077-172638099 CCAATCAGACTCATAAACCTCAA No data
Right 1001556081 5:172638108-172638130 TCACCCCCATGGCTTCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001556081 Original CRISPR TCACCCCCATGGCTTCATGT GGG Intergenic