ID: 1001557738

View in Genome Browser
Species Human (GRCh38)
Location 5:172647852-172647874
Sequence CTCATCTGCCTGGTAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001557734_1001557738 1 Left 1001557734 5:172647828-172647850 CCCAACTAGGACTCAGGCTCCTG 0: 1
1: 0
2: 1
3: 9
4: 203
Right 1001557738 5:172647852-172647874 CTCATCTGCCTGGTAAAAACTGG 0: 1
1: 0
2: 2
3: 16
4: 153
1001557733_1001557738 5 Left 1001557733 5:172647824-172647846 CCTGCCCAACTAGGACTCAGGCT 0: 1
1: 0
2: 1
3: 2
4: 136
Right 1001557738 5:172647852-172647874 CTCATCTGCCTGGTAAAAACTGG 0: 1
1: 0
2: 2
3: 16
4: 153
1001557731_1001557738 12 Left 1001557731 5:172647817-172647839 CCTTCTTCCTGCCCAACTAGGAC 0: 1
1: 0
2: 1
3: 15
4: 222
Right 1001557738 5:172647852-172647874 CTCATCTGCCTGGTAAAAACTGG 0: 1
1: 0
2: 2
3: 16
4: 153
1001557735_1001557738 0 Left 1001557735 5:172647829-172647851 CCAACTAGGACTCAGGCTCCTGA 0: 1
1: 0
2: 0
3: 17
4: 203
Right 1001557738 5:172647852-172647874 CTCATCTGCCTGGTAAAAACTGG 0: 1
1: 0
2: 2
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001557738 Original CRISPR CTCATCTGCCTGGTAAAAAC TGG Intronic
901317859 1:8321132-8321154 CACTTCTGCATGGTAAAACCTGG - Intronic
907368590 1:53982486-53982508 CCCTCCTGCCTGGAAAAAACTGG + Intergenic
908441106 1:64155661-64155683 CTCACCTGCCTGGCAAACAAAGG - Intronic
909228498 1:73056951-73056973 CTCATCTTCCTGGTAGCAGCTGG + Intergenic
909293885 1:73919941-73919963 CTCTGCTGCCTGGTACAAATTGG - Intergenic
910431323 1:87162222-87162244 CTCACCTGGGTGGTAAAAATAGG - Intronic
913502873 1:119488114-119488136 TTCATCTGCAGGGTAAAAAGGGG + Intergenic
913539894 1:119808714-119808736 CTGAGCTGCCTGGCCAAAACAGG - Exonic
914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG + Intergenic
916926594 1:169527904-169527926 CCCTTCTGCCTGGTAAAGATTGG - Exonic
919849271 1:201661595-201661617 CTTAACTGCCTGGTAAAATAGGG + Intronic
922329121 1:224558180-224558202 CTCACCTGCCTGATGATAACTGG + Intronic
923911458 1:238449824-238449846 CTCACCAGCTTGGTAAGAACAGG - Intergenic
1063388868 10:5635588-5635610 CTCAACTGCCTAGAAGAAACAGG + Intergenic
1066978720 10:42391947-42391969 TTCATCTGCCAGGTCAAAAGGGG + Intergenic
1068133877 10:52930796-52930818 TTCATCTGTGTGGTCAAAACTGG + Intergenic
1074206681 10:111288834-111288856 CTCATCTGGCTGGAGAAAAAAGG + Intergenic
1076007044 10:126956148-126956170 CTGATCTGCCTGGGAACAAGAGG + Intronic
1078800723 11:14642614-14642636 CTCATCTGCCTGGAAAAATGTGG + Intronic
1082776954 11:57252904-57252926 TTCATCTGCATGGTCAAAGCTGG - Intergenic
1084685199 11:70689618-70689640 CTCACCTGCCAGGGATAAACAGG + Intronic
1085192869 11:74644055-74644077 CTCACCTCCCTGGAAAAAACTGG + Intronic
1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG + Intronic
1086412684 11:86558133-86558155 CCCATCTACCTGGAAATAACTGG + Intronic
1086695125 11:89834930-89834952 CTCATCTGCTCTGGAAAAACTGG + Intergenic
1086711027 11:90009554-90009576 CTCATCTGCTCTGGAAAAACTGG - Intergenic
1088070402 11:105776988-105777010 CTCTTCTCCCTGGATAAAACTGG - Intronic
1088478860 11:110273093-110273115 CTCAGCTTCCTGGAAATAACAGG - Intronic
1089703495 11:120260140-120260162 CACTTCTGCCTGGTAAACAATGG - Intronic
1090025594 11:123165118-123165140 TCCATCAGGCTGGTAAAAACTGG - Intronic
1090119186 11:124006288-124006310 CTGAACTGCCTGTTATAAACTGG - Intergenic
1093661259 12:21759922-21759944 TTCATCAGCCTGGTCAAAGCTGG + Intergenic
1094019909 12:25903176-25903198 CTAATCTTCCTGGTAGAAAGTGG - Intergenic
1097842753 12:64337908-64337930 CTCCTCTCCCTGGTATAAAGAGG - Intronic
1098372983 12:69780065-69780087 GTCATCTTCGTGGTAAAAATGGG - Intronic
1099353303 12:81601334-81601356 CTCTTCTGCCTGGTAGCAATAGG + Intronic
1100696339 12:97098067-97098089 CTCTTCTGGCTGGTAGGAACAGG - Intergenic
1102515807 12:113445877-113445899 CTCATGTGCCTGGTCAAAATTGG + Intergenic
1102972966 12:117185522-117185544 CTCATCTTTCAGGGAAAAACTGG + Intronic
1103004059 12:117407742-117407764 CTCACCTGCCTGGGAAAGTCAGG - Intronic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1106413850 13:29529549-29529571 CTCATCTGCCTGGTCAGAGCTGG - Intronic
1111005724 13:82245732-82245754 TTTATCTGCCTAGTAAAACCAGG + Intergenic
1114817297 14:25975480-25975502 CTCATCTACTTGCTAAAACCTGG - Intergenic
1117027503 14:51636563-51636585 CTCATTTGCCTCACAAAAACAGG - Intronic
1120198076 14:81508253-81508275 CTCATCATCCTGGTAATAAGAGG + Intronic
1122019300 14:98823224-98823246 CTCATATGCCATATAAAAACCGG - Intergenic
1122993832 14:105251759-105251781 GTCATCTGCTTGGTAAAGAAAGG + Intronic
1125451357 15:39811029-39811051 CTAATATGCCAGGTAACAACAGG + Intronic
1126851574 15:52800286-52800308 TTCATTTGCCTGGCAAAACCTGG + Intergenic
1127304923 15:57696275-57696297 CTCAGCTGCCTGGAAAAACTAGG - Intronic
1128742254 15:70092004-70092026 TACATCTGCCTGGAACAAACAGG - Intronic
1129814267 15:78538343-78538365 CTAAGCTGCCTGGTTACAACTGG + Intergenic
1131587161 15:93707885-93707907 CTCATCTGCCAGGTTACATCTGG - Intergenic
1131686867 15:94777603-94777625 CTCATATGACAGGTAAAAACAGG - Intergenic
1132278766 15:100594050-100594072 CTCAACTCCCTGGCAAAAAATGG + Intronic
1133385976 16:5370839-5370861 GTCATGTGCCTGCTAAAAATTGG - Intergenic
1138795818 16:59967831-59967853 CTCATCTGCAGGGTCCAAACAGG + Intergenic
1139749763 16:69102527-69102549 CTTATCTGCCTGATAACACCAGG + Intergenic
1140627873 16:76816226-76816248 TTCATCTGCCTGCAAAAATCTGG - Intergenic
1140940801 16:79720128-79720150 CTCATCAGATTGGTAAAAATGGG + Intergenic
1141140047 16:81491358-81491380 CTCGTTTTCTTGGTAAAAACGGG + Intronic
1142571487 17:877799-877821 CTGGCCTGCCTGGTGAAAACCGG - Intronic
1142731421 17:1861018-1861040 CCCATCTGACTGGTAGAAACAGG + Intronic
1142841270 17:2632803-2632825 CTCATATCCCTGATAAAAAATGG - Intronic
1143823403 17:9584109-9584131 CTGACCAGCCTGGTAAGAACAGG - Intronic
1147773499 17:42884022-42884044 GTCATCTGGCTGGTAAAAGGTGG + Intergenic
1148217976 17:45844308-45844330 GTCATGTGCCTGGTAGAAATGGG + Intergenic
1151047855 17:70942611-70942633 CTCATCTTTCTGGCAAAAAGAGG - Intergenic
1156789107 18:40950411-40950433 CTCATCTGCATGGCAAACAAAGG - Intergenic
1156839859 18:41598812-41598834 CTCAACTGCCTAATAAAAATGGG + Intergenic
1157401051 18:47388202-47388224 CTAATCTGCTGGGTATAAACTGG + Intergenic
1158744254 18:60179905-60179927 TTCATCTGACTGGTAATAAAAGG - Intergenic
1159638978 18:70841010-70841032 CTCATCTGCCTTATGAAAATAGG - Intergenic
1161763598 19:6193026-6193048 CTCACCTGCCTGGAAGCAACTGG + Exonic
925809067 2:7680561-7680583 CTCATCTCCCAGGTGAAAACAGG + Intergenic
927718000 2:25364838-25364860 CCCAGCTGCCTGGGAAAGACTGG - Intergenic
932347949 2:71007775-71007797 CTCCTCTGCCTGGCACACACAGG - Intergenic
934724070 2:96603727-96603749 CACATCTGCCTGAATAAAACTGG - Intronic
935531142 2:104234029-104234051 CTCCTTTGCCTGGTAAAATGGGG - Intergenic
938716448 2:134026747-134026769 CTCCTATGCCTGGCAAATACTGG + Intergenic
939496392 2:142932581-142932603 CTCGTCTACCTGGAAAAAACGGG - Intronic
1169202379 20:3718114-3718136 CTCACCTGTCTGGTAATACCTGG - Intergenic
1169436557 20:5597714-5597736 CTCATCTGCATGATAAAAAGGGG - Intronic
1169685463 20:8266726-8266748 CTCATCTGCCTGTTAAGAATGGG + Intronic
1170470230 20:16661317-16661339 TTCATCAGCCTAGCAAAAACTGG - Intergenic
1172043332 20:32061598-32061620 CTCATCACCCTGGCAAAGACAGG - Intronic
1172768794 20:37364968-37364990 CTCCTCTGGCTGGGAGAAACTGG - Intronic
1174544050 20:51311926-51311948 TTCATCTGCATGATAAAACCTGG - Intergenic
1175676858 20:60953611-60953633 CTCAAATGCCTGGTAGAAAAGGG - Intergenic
1176989515 21:15478414-15478436 CTCATCTCCCTGGCACAAAGGGG - Intergenic
1177199747 21:17941146-17941168 CTCATCTACTTGGTAAAATATGG + Intronic
1180094358 21:45549100-45549122 CTCATGTAACTGCTAAAAACTGG + Intergenic
1180954703 22:19736489-19736511 CTCCTCTGCCTTGTAAAGATGGG + Intergenic
1183386224 22:37516294-37516316 CTCATCTGCCAGGACAGAACAGG + Exonic
1184029397 22:41882902-41882924 CCCATCAGCCTGGGAAACACGGG + Intronic
1184325245 22:43778191-43778213 CTCATGTGGCTGCTAAATACTGG - Intronic
1184806928 22:46801252-46801274 CTTAACTGCCTTATAAAAACAGG - Intronic
1184997724 22:48222701-48222723 CTCATCTGGCTGGCAAAAGTGGG + Intergenic
1185220592 22:49627418-49627440 CCTACCTGCCTGGGAAAAACTGG - Intronic
952983529 3:38757435-38757457 CTCATTTCCCTGGTATGAACTGG - Intronic
956683932 3:71806854-71806876 CTCAACTACCTGGTCAAAAATGG - Intergenic
959634663 3:108551720-108551742 CTCATCTTCCTGGTAGTAAACGG + Intronic
960698524 3:120418738-120418760 CTCAGCTTCCTCGTGAAAACTGG + Intronic
960865953 3:122201118-122201140 GTCCTCTGCCTGGGAAAACCAGG - Intronic
961159939 3:124715349-124715371 CTCAGTTGCCTGGTAAAGAAAGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
964157213 3:153600612-153600634 CTACTCAGCCTGGTAAATACTGG + Intergenic
965803211 3:172515545-172515567 CTCCTCTGGCTGGCAAAATCTGG + Intronic
967270364 3:187727808-187727830 CTTTTTTGTCTGGTAAAAACTGG + Intronic
974087329 4:57275379-57275401 CTCAAGTGCCTGGTAGAATCAGG - Intergenic
974563167 4:63548467-63548489 CACATCTGCCTAGTAAAGAGTGG + Intergenic
977086818 4:92610224-92610246 CCCATCTGCCTGGTAAAACCTGG - Intronic
977589919 4:98814695-98814717 CTCAGCTGGAAGGTAAAAACAGG - Intergenic
979983967 4:127292635-127292657 CTAATCTGTCTGGTGGAAACAGG - Intergenic
980859835 4:138486054-138486076 CTCTTCTGCCTGGGGAAAATTGG - Intergenic
981438187 4:144750693-144750715 TTCATCTATCTGTTAAAAACTGG + Intergenic
985476331 5:81364-81386 CCCATCTTCCTGGAAAAACCTGG + Intergenic
985909096 5:2864964-2864986 CTCCTCTCCCTGTGAAAAACTGG - Intergenic
992149732 5:73891158-73891180 CTCATCTGCTTGGTGAGAAGAGG + Intronic
993462413 5:88199994-88200016 CTCATTTGCCAGATAAAACCTGG + Intronic
995311463 5:110717039-110717061 CTCATGTCCCTGGTACAAAGTGG - Intronic
995491235 5:112693463-112693485 CTGATGTGCTTGGAAAAAACCGG + Intergenic
995741402 5:115359445-115359467 TTCATCTGCATGATAAAACCTGG + Intergenic
996410229 5:123151139-123151161 CTCAGCTGCTTGGCGAAAACTGG + Intronic
998045114 5:138980827-138980849 CTCCTGTGCTTGGTAACAACAGG + Intronic
999342301 5:150782579-150782601 CTCTTCTGCCTGGTATGTACAGG + Intronic
999613442 5:153396116-153396138 CTCATCTGCATGGTCTAAAATGG - Intergenic
1001535404 5:172494563-172494585 CTCATCAGCCTGGGGGAAACAGG - Intergenic
1001557738 5:172647852-172647874 CTCATCTGCCTGGTAAAAACTGG + Intronic
1003464100 6:6361730-6361752 CTAATATGGATGGTAAAAACTGG + Intergenic
1003577482 6:7311044-7311066 ATCATATCCATGGTAAAAACTGG + Intronic
1004352884 6:14905849-14905871 ATCAACTGCCAGGGAAAAACAGG + Intergenic
1006586404 6:35117436-35117458 CACCTCTGCCTGGAAAAACCGGG + Intergenic
1007666989 6:43520271-43520293 GTCATATGCCTGGTATACACTGG - Exonic
1008851259 6:56025189-56025211 CTCATCTGTATGCTAAAAACTGG - Intergenic
1010287331 6:74094330-74094352 CTTATGTGCCTGATAAAAAATGG - Intergenic
1010416085 6:75613166-75613188 CTCATGAGCCTCTTAAAAACAGG - Intronic
1012677189 6:102130785-102130807 CCAATCTGGCTGGTAAGAACAGG - Intergenic
1013795643 6:113885470-113885492 TTCATTTGCCTGGTAAATTCAGG + Intergenic
1014855509 6:126396288-126396310 CTCATCTGCCTGTGGAAAGCAGG - Intergenic
1021663874 7:22952766-22952788 CTAATCTGCCTTGTAAATACTGG - Intronic
1021758423 7:23878642-23878664 CTCATCTGCATGGTCAAAGATGG + Intergenic
1024220396 7:47282296-47282318 CTCATCTGCATGGTAGACTCAGG - Intronic
1026168001 7:67928155-67928177 CTCATCTGAGTGGTAATAAAAGG - Intergenic
1026559085 7:71433180-71433202 GTCATCTTCCAGATAAAAACAGG + Intronic
1027745760 7:82071920-82071942 CTCATCTGTCTGATTAAAATGGG - Intronic
1031133150 7:117856303-117856325 CTCATCAGCATGCTTAAAACAGG - Intronic
1033359978 7:140632123-140632145 TTCATGTGCCTGGTAAATATAGG - Intronic
1033926236 7:146464453-146464475 CTCATCTGCCTTGTGGAAATTGG + Intronic
1034029473 7:147744240-147744262 CTCATATACCTTGTAAAAAGGGG - Intronic
1034918074 7:155057273-155057295 CTCATCTGCGAAGTAAAAATTGG + Intergenic
1036055831 8:5252688-5252710 CTCATCTTTCAGATAAAAACTGG - Intergenic
1036076733 8:5510789-5510811 CTCCTCTGCCTGTTTAAAAGTGG + Intergenic
1036643522 8:10598624-10598646 CTCATCTCCCTGGAAAAGGCTGG - Intergenic
1039212298 8:35231630-35231652 CACATGTGCCTGGAAAAAAACGG + Intergenic
1039775530 8:40732528-40732550 CTCTTCTCCCTGGTAGGAACAGG + Intronic
1043311668 8:78867750-78867772 CACCTCTTCATGGTAAAAACTGG - Intergenic
1044736679 8:95286035-95286057 CACATCTGCCTGGTCAAAACTGG - Intergenic
1049993811 9:1015850-1015872 CTCAACTGCCTGGAAGAATCAGG - Intergenic
1050864468 9:10480292-10480314 CTCAGCTGCCTGGTAGAGAATGG - Intronic
1057899959 9:98941017-98941039 CTCATGTTCCTGTTAAAAATGGG - Intergenic
1185525334 X:774002-774024 CTCATCAGCTGGGTAAGAACTGG + Intergenic
1189613689 X:42763810-42763832 TTCATCTGCCAGGTCAAAAGGGG - Intergenic
1189656246 X:43247869-43247891 CTCTTCTTCCAGTTAAAAACTGG - Intergenic
1189839204 X:45054327-45054349 CTCATCTGCCTGATGACTACTGG + Intronic
1195430277 X:104781580-104781602 CTCATCTGCATAGTTAAAACTGG + Intronic
1197260438 X:124311830-124311852 CACATCTGTCTGGTGAACACTGG - Intronic
1198303958 X:135361590-135361612 GTCATTTGCCTGGTAAGAACTGG + Exonic
1199415762 X:147581297-147581319 TTCATGTGGCTGGTAAAAACAGG - Intergenic
1199545027 X:148999369-148999391 CTCTTCTTCCTGGAAAAAAAAGG + Exonic
1201888704 Y:18917586-18917608 TTCATCTGCATGATAAAAACTGG + Intergenic