ID: 1001559981

View in Genome Browser
Species Human (GRCh38)
Location 5:172662787-172662809
Sequence CTGTGGGTGGTTAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 605}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001559981_1001559994 25 Left 1001559981 5:172662787-172662809 CCCTCCTCCCTAACCACCCACAG 0: 1
1: 0
2: 3
3: 59
4: 605
Right 1001559994 5:172662835-172662857 TCTGCCATGCATTTCGAGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1001559981_1001559995 26 Left 1001559981 5:172662787-172662809 CCCTCCTCCCTAACCACCCACAG 0: 1
1: 0
2: 3
3: 59
4: 605
Right 1001559995 5:172662836-172662858 CTGCCATGCATTTCGAGTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001559981 Original CRISPR CTGTGGGTGGTTAGGGAGGA GGG (reversed) Intronic
900950264 1:5854656-5854678 CTGGGGGCTGTTAGGGAAGAAGG - Intergenic
901421069 1:9151573-9151595 CGGTGGGTGGTGAGGGCGGCTGG - Intergenic
901749097 1:11395170-11395192 CTGTGGGAGCTTAGGAAGGGCGG + Intergenic
902404214 1:16174230-16174252 CTCTGGGTGGATGGAGAGGAGGG - Intergenic
902866697 1:19284658-19284680 CTGTGGGTGCTTGGTGTGGATGG - Intronic
903545179 1:24119468-24119490 CTGTGGGGGATCAGGGAGGCTGG + Intergenic
904000150 1:27334290-27334312 GTGTGGGTGGGCAGGCAGGAGGG - Intronic
904212901 1:28897543-28897565 CTGTAGGTAGGTAGGTAGGAAGG + Intronic
904227304 1:29033263-29033285 CTGTGTCTGGTTTGGGAGGAAGG - Intronic
904253591 1:29240773-29240795 GTGTGAGTGGCTGGGGAGGAGGG + Intronic
904287825 1:29463502-29463524 CTGTGGCTGGAGTGGGAGGAGGG - Intergenic
904314355 1:29650656-29650678 CGGTGGGTGGGCAGGGTGGAGGG + Intergenic
904444073 1:30553412-30553434 CTGTGGGTGGTTGGGTGGAATGG - Intergenic
904499391 1:30905413-30905435 CTGTGGTTGGGAAGGCAGGAGGG - Intronic
904604583 1:31691643-31691665 CTGTGGGGGGATAAGGGGGAGGG + Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905491677 1:38349130-38349152 CTGTGGGAGGTTTGGGAGCCAGG - Intergenic
906130064 1:43450658-43450680 CTGTGGGTGTTTGGGGAGGGCGG - Exonic
906308663 1:44737947-44737969 CTTTGGGAGGTTAAGGAGGGAGG + Intergenic
907339785 1:53726703-53726725 CTGGGGGAGGTTGGGGAGGGAGG - Intronic
907371277 1:54005130-54005152 CTGTGGATGGTTTGGGGGGTGGG + Intergenic
907523137 1:55038191-55038213 CTGAGGGAGGTGGGGGAGGAAGG - Intergenic
907751725 1:57269480-57269502 CTGTGAGTGGCCAGGGAGGGGGG - Intronic
908590106 1:65621939-65621961 ATGTGCCTGGTCAGGGAGGATGG + Intronic
909252984 1:73381789-73381811 CTGTGGGTTGCCAGGGATGAAGG + Intergenic
909327350 1:74367424-74367446 CTTTCAGGGGTTAGGGAGGAGGG + Intronic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
910241088 1:85086941-85086963 CTGTGGGAGATTAGGGCAGAGGG - Intronic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
912832716 1:112967928-112967950 CAGAGGGAGGGTAGGGAGGAAGG - Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
914377798 1:147087887-147087909 CTTTGGGAGGTGAGGCAGGAGGG - Intergenic
914530771 1:148522487-148522509 CTGTGGGTGGTGGGGGGGGGGGG + Intergenic
915034827 1:152912840-152912862 CTGGGGTTGGGTGGGGAGGAAGG - Intergenic
915320228 1:155052194-155052216 ATGAGGGTGTTTAGGGAGGTGGG + Intronic
915997329 1:160576491-160576513 CTGTGGGTGGGTATAGAGAAAGG + Intronic
916145426 1:161735015-161735037 CTGTTGGGGGCTAGGGAGGTAGG - Intergenic
916226313 1:162493204-162493226 CTTTGGGAGGCTAAGGAGGAAGG + Intergenic
917642382 1:176995760-176995782 CTTTTGGTGGCTAGAGAGGAAGG + Intronic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
917801408 1:178573844-178573866 CTGTGGGTGTATGGGGAGCAGGG - Intergenic
918109675 1:181444419-181444441 CTATGGGGGGAAAGGGAGGAGGG + Intronic
918122230 1:181550038-181550060 TTGGGGGTAATTAGGGAGGAAGG + Intronic
918533765 1:185551657-185551679 CTTTGGGAGGTGAGGGAGGGTGG + Intergenic
918678614 1:187322703-187322725 CTGTTGGGGGTTGGGGAGCAAGG + Intergenic
918914959 1:190623075-190623097 TTGTGGGGGGTGAGGGAGGTGGG + Intergenic
919853276 1:201688241-201688263 GTGAGGGTGGTTAGGGAGGGTGG + Intronic
919944166 1:202307678-202307700 TTGTTGGTGGATAGAGAGGATGG - Intronic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
920692316 1:208156014-208156036 ATGTGGCTGGTGAGGGAGGATGG + Intronic
920987141 1:210901428-210901450 CAGTGGGTGGTCAGGTTGGATGG + Intronic
921683919 1:218067991-218068013 CAGTGGTTGGTAAAGGAGGAGGG + Intergenic
922276866 1:224087277-224087299 CTTTGGGAGGTCAGGGAGGGAGG - Intergenic
922879125 1:228966396-228966418 CTGGGGGTGCTTTGGGAGGGAGG - Intergenic
922919062 1:229285251-229285273 CTTTGGGAGGTTAAGGAGGGAGG - Intronic
924148520 1:241102410-241102432 CTGATAGTGGTTAGTGAGGAAGG - Intronic
924329089 1:242924451-242924473 CTGCTGCTGGTGAGGGAGGAAGG + Intergenic
924863059 1:247946728-247946750 CTGGGGGTGATTATGGAGGAGGG - Intronic
924872053 1:248058372-248058394 CTGGGGGTGATGACGGAGGAGGG - Intronic
1063219586 10:3954365-3954387 CTGTTGGTGGGTAGGGGGCAGGG + Intergenic
1063298270 10:4827465-4827487 CTGGGGGAGGTGAGGAAGGAGGG - Intronic
1063440940 10:6072475-6072497 CTGTGGGTCTTTATGGATGAGGG - Intergenic
1064220943 10:13439949-13439971 CTGTGGGTGTTTAGGGCGACTGG - Intronic
1064279516 10:13938837-13938859 CTGTTGGAGGTTGGGGAGGACGG - Intronic
1064615267 10:17147482-17147504 CTGGAGGTGGATGGGGAGGATGG - Exonic
1065581903 10:27180633-27180655 CTTTGGGTGGCTGGGGAGGGTGG - Intronic
1065908171 10:30278116-30278138 CTGTCGGTGGGTAGGGAGAAAGG + Intergenic
1065914850 10:30345801-30345823 CTTTGGGAGGTCAGGGAGGGTGG + Intronic
1067429139 10:46231357-46231379 CTGTGGGTGGCCAGGGTGGAGGG + Intergenic
1067684359 10:48457920-48457942 TTGGGGGTGGGTAGGGAGGGGGG + Intronic
1069565234 10:69459630-69459652 CTGTGGGTGGAGAGGGTGGCAGG + Intronic
1070047156 10:72849426-72849448 TTATGGGTGGTTAGGGAAGATGG + Intronic
1070669999 10:78371081-78371103 CTTTGGGTGGTGAGGTTGGAAGG + Intergenic
1070764911 10:79050859-79050881 CTGGGGGTGGGTGGGGAGAAGGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070847962 10:79539283-79539305 GTGTCTGTGGTTGGGGAGGAAGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071096030 10:81975910-81975932 CTGTGGCTGGCTTGGAAGGAAGG + Intronic
1071913759 10:90266737-90266759 CTGGGGGTGGTCTGGGGGGAGGG + Intergenic
1072234454 10:93441132-93441154 CTGGGGTTGGTTGGTGAGGAAGG - Intronic
1072235273 10:93448200-93448222 CATTGGGGGGTTAGGGAGTAGGG - Intronic
1072242177 10:93506815-93506837 CTCTGGGAGGTTAAGGAGGGTGG - Intronic
1072280860 10:93863952-93863974 CAGTCAGTGGTTATGGAGGATGG + Intergenic
1072290707 10:93961874-93961896 CAGGCGGTGGCTAGGGAGGACGG - Intergenic
1072899361 10:99393752-99393774 CTCTGGGTTGTTGGGGAAGAGGG - Exonic
1073115198 10:101087883-101087905 CAGTGGGTGGAGAGGAAGGAGGG - Intergenic
1073192728 10:101663198-101663220 CTGTCCCTGGTTGGGGAGGAAGG - Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074112390 10:110431775-110431797 CTGAGGGTTGGTAGGGATGAGGG + Intergenic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075455994 10:122585421-122585443 CTGTGGGTTGCATGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458121 10:122598124-122598146 CTGTGGGTTGCATGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075536016 10:123272988-123273010 CTGTGGGTGTTTGGTAAGGATGG - Intergenic
1076413080 10:130265583-130265605 CTGTGGGAGGGTAGTGAGAAGGG + Intergenic
1076652902 10:132002253-132002275 CTCTGTGTGGGCAGGGAGGATGG - Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1077260619 11:1617638-1617660 CTTTGGGAGGTTAAGGAAGAAGG - Intergenic
1078611121 11:12820330-12820352 CTGTGGGTGGGTGGGGTGGGAGG - Intronic
1079244786 11:18744098-18744120 CTGAGGGCGGCGAGGGAGGAGGG + Exonic
1079248205 11:18768865-18768887 CTCTTGGTGGGGAGGGAGGAAGG - Intronic
1079300443 11:19274272-19274294 CTTTGGGAGGTCAAGGAGGATGG + Intergenic
1079943331 11:26710013-26710035 CTGTGGGTGGGTAGGGGGCTAGG - Intronic
1080505723 11:32911282-32911304 CTGGGGGTGGTGGGGGAAGACGG + Intronic
1080813229 11:35726914-35726936 CTTTGGGAGGCTAGGGTGGAAGG + Intronic
1081994161 11:47352867-47352889 CTGCGGGGGGTGAGGGGGGAAGG - Intergenic
1083250660 11:61464466-61464488 CTTTGGGAGCTCAGGGAGGAAGG - Intronic
1083290035 11:61684723-61684745 CTGTGGGAAGTGAGGGCGGAGGG + Intronic
1083427755 11:62597582-62597604 GGGTGGGTGGATAGGGAAGATGG - Intronic
1083438707 11:62661686-62661708 CTTTGGGAGGTTAAGGTGGATGG + Intronic
1083564968 11:63706441-63706463 CTGTGGATGGCTAAGGTGGAAGG - Intronic
1083773227 11:64879647-64879669 CTGTGTGTGGCCGGGGAGGATGG - Intronic
1084402967 11:68955894-68955916 CTGTGTGTGGCTGGGAAGGAGGG - Intergenic
1084424710 11:69078347-69078369 CTGTGGCTGGATAGATAGGACGG + Intronic
1084612439 11:70212211-70212233 CTTGGGGTGGATAGTGAGGAAGG - Intergenic
1084862113 11:72025884-72025906 TTGTGGGTGGGTAGGGAAAATGG - Intronic
1085403735 11:76249602-76249624 ATGGTGGGGGTTAGGGAGGAAGG - Intergenic
1085462418 11:76702127-76702149 CTGGGGGTGTTCACGGAGGATGG - Intergenic
1086348741 11:85923972-85923994 GTGTAGGTGGTGAGTGAGGAGGG - Intergenic
1087036745 11:93763901-93763923 TTTTTGGTGGTTAGGGAGTAGGG + Intronic
1087883340 11:103446059-103446081 TTGTTGTTGTTTAGGGAGGAGGG + Intronic
1088622241 11:111697746-111697768 CTTTGGGTGCTGAGGCAGGAGGG + Intronic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089225952 11:116922257-116922279 CTTTGGGAGGTTAAGGAGGGAGG + Intronic
1089423106 11:118346570-118346592 CTTTGGGAGGCTAGGGAGGGAGG + Intronic
1089677553 11:120099960-120099982 GTGTGGGTGGTTTGGCAGGTGGG + Intergenic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1090034231 11:123234528-123234550 CTGTGTGTGGTTATGGGGGATGG - Intergenic
1090076666 11:123584206-123584228 CGGAGGGTGGGCAGGGAGGAGGG - Intronic
1090793168 11:130110077-130110099 CTTTGGGAGGCTGGGGAGGATGG - Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092008210 12:5087388-5087410 GTGTGTGTGGTTGGGGAGGGCGG + Intergenic
1092096948 12:5850581-5850603 ATGTGGTGGGTTAGGGAGTAGGG - Intronic
1092277554 12:7073282-7073304 CTTTGGGAGGCCAGGGAGGATGG + Intergenic
1092627306 12:10340601-10340623 CAGAGGGTGGGTGGGGAGGAGGG - Intergenic
1092824612 12:12386789-12386811 GTATGGGTGGGCAGGGAGGAAGG - Intronic
1093497187 12:19771730-19771752 ATGTTGGTGGTTAGGGAGGAAGG + Intergenic
1097022637 12:56031467-56031489 CTTTGGGTGGATAGGGACCATGG + Intronic
1097143763 12:56925506-56925528 TTGTGGGTGGTTGGTGAGAATGG + Intronic
1097143924 12:56926509-56926531 CTGTGGGTGATGATTGAGGAGGG - Intronic
1097233408 12:57525457-57525479 CTGAGGGTGGTTCTGGGGGAAGG - Exonic
1097806139 12:63967090-63967112 CTGTGAGCCGTTTGGGAGGAGGG + Intronic
1098030012 12:66243719-66243741 CTGTGGGTGGTCATGGAGCCAGG + Intronic
1098109106 12:67102817-67102839 CATTGGATGTTTAGGGAGGAGGG - Intergenic
1098112181 12:67134323-67134345 CTGTCGGGGGATAGGGAGCAAGG + Intergenic
1098610070 12:72445923-72445945 CACTGGTTGGTTAGGGATGAAGG + Intronic
1098918022 12:76277156-76277178 CTGTGGGGAGGTGGGGAGGAAGG - Intergenic
1098974533 12:76888920-76888942 GTTTGGGAGGTTAGGGAGGCAGG + Intergenic
1099133667 12:78865446-78865468 CTGTGCGTGCTTAGGGTGGGAGG - Intronic
1099152889 12:79137337-79137359 CTTTGGGAGGTTGGGGTGGATGG - Intronic
1100667358 12:96769422-96769444 GTGTGGGTGGATGGGGAGCAGGG + Intronic
1100670151 12:96802825-96802847 CTGTCGGTGGGTAGGGAGCAGGG - Intronic
1101059371 12:100954989-100955011 CTGTGGGCAGTTATGGTGGAAGG - Intronic
1101120781 12:101577532-101577554 CTTTGGGAGGTCAAGGAGGACGG - Intronic
1101434322 12:104652124-104652146 CTGGGGGTGGGTGGGAAGGATGG - Intronic
1101763463 12:107677890-107677912 CTGTGGGTGGTTGGTTAGGGAGG - Intergenic
1102195699 12:111023774-111023796 TTGTGTTTGGTTTGGGAGGAAGG + Intergenic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1103084565 12:118052515-118052537 GTCTGGGTGGTCAGGGAGCAAGG - Intronic
1103589404 12:121980589-121980611 CTGTGGGAGGCTAAGGAGGGTGG - Intronic
1103662625 12:122533449-122533471 CTTTGGGTGGTTGGGATGGAAGG + Intronic
1104087137 12:125485747-125485769 CTGTGATGGGTTAGGCAGGATGG + Intronic
1104710533 12:130982671-130982693 CTGTGCGTGGTCTTGGAGGAGGG + Intronic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108962449 13:56251679-56251701 TTGGGGATGGGTAGGGAGGATGG - Intergenic
1109913522 13:68948816-68948838 GTGTGTATGTTTAGGGAGGAGGG + Intergenic
1111888162 13:94049294-94049316 CAGTGGGGGGTTGGGGAGGAGGG - Intronic
1112558426 13:100490722-100490744 CTGTGGCTGGCCAGGGAGCAGGG - Intronic
1113064374 13:106358696-106358718 CACTGGGTGGTTTTGGAGGATGG - Intergenic
1113452771 13:110423433-110423455 CTGTGGGTGGGTCGGGGGGAGGG + Intronic
1113892811 13:113745321-113745343 CTGTGGCTGGTTTGGGAGACGGG - Intergenic
1114417394 14:22553958-22553980 GTGTGGGTGGCTGGGGAGGCAGG + Intergenic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1115139564 14:30154617-30154639 CTGTGAGAAGTTAGGGAAGATGG - Intronic
1116057602 14:39883392-39883414 GAGTGGGTGGTAAGAGAGGAGGG - Intergenic
1116985018 14:51209446-51209468 CTGTTGGTGGTTGGGAAGGCAGG + Intergenic
1117015641 14:51514340-51514362 CTGTTGGGGGTTAGGGGGCAAGG + Intronic
1117790073 14:59331292-59331314 GTGGGGGTGGTGGGGGAGGAAGG - Exonic
1117819232 14:59630842-59630864 GGGTGGGAGGTTTGGGAGGAGGG + Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118403433 14:65400640-65400662 CTTTGGGAGGTTTGGGAGGGAGG + Intergenic
1118430353 14:65713030-65713052 AGGTGGGGGGTAAGGGAGGATGG - Intronic
1118600321 14:67467449-67467471 CTGTGGGTGGGAAGGAGGGAGGG + Intronic
1118875784 14:69783843-69783865 GTGTGAGTGGTGAGGGAGAAGGG + Intronic
1119113468 14:71996767-71996789 GTGTGGGAGGTAGGGGAGGAAGG + Intronic
1119253997 14:73182598-73182620 CTGTGGGAGGCTAAGGAGGGTGG + Intronic
1119542624 14:75450747-75450769 CCTTGCGTGGTTAGGGAGGAAGG - Intronic
1119828877 14:77683093-77683115 CTCTGGGAGGTCAGGGCGGAAGG - Intronic
1120127719 14:80765642-80765664 CTTTTGGAGGGTAGGGAGGAAGG + Intronic
1120745023 14:88144936-88144958 CTGAGGCTGGATAGGGAGGTTGG - Intergenic
1120982847 14:90306329-90306351 CTGTGTTTGGTCAGTGAGGAGGG - Intronic
1121241333 14:92432066-92432088 GTGTGGATGGGTACGGAGGATGG + Intronic
1121553616 14:94820303-94820325 CTGGGGGTGGAGAGTGAGGAGGG - Intergenic
1122276463 14:100593235-100593257 CTGTGGGTGGTCGGGGTGGAGGG - Intergenic
1122597613 14:102904034-102904056 CTGTGGGTGCTGAGGCCGGAGGG + Intronic
1122605860 14:102947381-102947403 CTGTGGCAGGTTAGGCATGAAGG - Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122916066 14:104859536-104859558 TGGTGGGTGGTGATGGAGGATGG - Intergenic
1122916141 14:104859846-104859868 TGGTGGGTGGTGATGGAGGATGG - Intergenic
1122916217 14:104860206-104860228 TGGTGGGTGGTGATGGAGGATGG - Intergenic
1122916262 14:104860412-104860434 TGGTGGGTGGTGATGGAGGATGG - Intergenic
1123468172 15:20531234-20531256 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123649943 15:22469830-22469852 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123728488 15:23126444-23126466 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123740346 15:23278649-23278671 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123746652 15:23323909-23323931 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124278920 15:28347225-28347247 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124303779 15:28564383-28564405 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1125997285 15:44174898-44174920 CTGTTGGGGGGTTGGGAGGAAGG + Intronic
1126476917 15:49074933-49074955 CTGTGGGAGGTGAGGGGGTAGGG + Intergenic
1127045401 15:55020146-55020168 CTTTGGCTGATTAGGGAGTAAGG - Intergenic
1127690363 15:61389617-61389639 CTGTGGGTGGTTTGTGAAGAAGG + Intergenic
1128068548 15:64779231-64779253 CTGGGGGTGGAGAGTGAGGATGG - Intergenic
1129825653 15:78633485-78633507 CTGTTGGTGGGAAGGGAGGAGGG + Intronic
1130659375 15:85818142-85818164 GTGTGGGTGGTGGGGAAGGAGGG - Intergenic
1130908733 15:88256931-88256953 GGGTGGGTGGGTGGGGAGGAGGG - Intergenic
1131387197 15:92017628-92017650 CTGTGGGTGGTAGGGGAGGGTGG + Intronic
1131540078 15:93268424-93268446 CTGTGGCTGGATGTGGAGGATGG + Intergenic
1131772753 15:95758041-95758063 CTGTTGGTGGGTAGGGAGAAAGG + Intergenic
1132036546 15:98489897-98489919 CTGTTGGTCTCTAGGGAGGAGGG - Intronic
1132484825 16:185391-185413 GTGTGGGTTATTTGGGAGGAGGG + Intergenic
1132499648 16:279834-279856 CTGTGGGTGGGTGGGGGGGATGG - Intronic
1132501499 16:286472-286494 CTGTGAGTGTTGAGGGAGGCAGG + Exonic
1132515270 16:363145-363167 CAGGCAGTGGTTAGGGAGGATGG + Intergenic
1132671150 16:1102779-1102801 CTGTGGGAGGTGAGGGGGGCTGG - Intergenic
1132676357 16:1122930-1122952 CTGTGGGTGGGTATGGAGGTAGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133845321 16:9448127-9448149 CTGTGGGTGGGTTGGGGAGATGG + Intergenic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1134479283 16:14603540-14603562 ATGTGGGTGGTGGAGGAGGAAGG - Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135323696 16:21512935-21512957 CTGTGGGGGGTTGGGGATGGAGG + Intergenic
1135385378 16:22034975-22034997 CTTTGGGAGGTCAAGGAGGATGG - Intronic
1135434063 16:22413410-22413432 CTTTGGGAGGCTAAGGAGGAAGG - Intronic
1135491886 16:22916428-22916450 GTCTGGGGGGTCAGGGAGGAGGG + Intergenic
1135736617 16:24936873-24936895 CTTTGGGAGGTTAGGGAGGGAGG + Intronic
1135910890 16:26559611-26559633 CTGAGGGGGGATAGGGAAGAGGG - Intergenic
1136595573 16:31247193-31247215 CTTTGGGAGGCCAGGGAGGATGG - Intergenic
1137473101 16:48780113-48780135 GTGTGAGAGGTTAAGGAGGAGGG - Intergenic
1137670256 16:50274438-50274460 CTGTGGTTGGTGGGGGAGGCTGG + Intronic
1138857563 16:60712921-60712943 CTTTGGGAGGTGAGGGAGGGAGG + Intergenic
1140255706 16:73334331-73334353 CTGCAGGGGGTTAAGGAGGAAGG + Intergenic
1140669569 16:77263929-77263951 CTGTGTGGGGGTGGGGAGGAGGG - Intronic
1142435379 16:90053377-90053399 CTCATGGTGGTTAGTGAGGAAGG + Intergenic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143584071 17:7842750-7842772 CTGTGTGTGTTCAGGGAGGCGGG + Intronic
1143636133 17:8164500-8164522 CTGTGGGAGGTGAGTGAGCAGGG + Intergenic
1143659334 17:8315110-8315132 CTGTGGGGGGTGGGTGAGGATGG + Exonic
1143688036 17:8534987-8535009 GTGCGGGTGGTGAGGAAGGACGG + Intronic
1144185214 17:12790045-12790067 GTCTGGGAAGTTAGGGAGGAGGG - Intronic
1144814041 17:18020902-18020924 CTTTGGGTGGCTGAGGAGGATGG - Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1145104120 17:20100812-20100834 CTGTTGGTGGGTAGGGGGCAAGG - Intronic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1146084078 17:29811237-29811259 TTTTGGGTGGCTAAGGAGGATGG - Intronic
1147047406 17:37763719-37763741 CTGTCGGTGGGTAGGGGGCAAGG - Intergenic
1147262732 17:39218017-39218039 CTGTGGGTGGTGGGGAGGGAGGG + Exonic
1147478357 17:40735503-40735525 CTTTGGGAGGTTAAGGAGGGAGG + Intergenic
1147916049 17:43887107-43887129 CTTTGGGAGGTCAAGGAGGAAGG + Intronic
1148153721 17:45411088-45411110 CTCTGGGTCCTTAGAGAGGAGGG - Intronic
1148381787 17:47205036-47205058 CTCTGTGTGGTTAGAGATGAAGG + Intronic
1148837871 17:50475884-50475906 ATGAGGTTGGTTGGGGAGGAAGG - Intergenic
1148890070 17:50800804-50800826 CGGAGGATGGTTAGGGAAGATGG + Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149168787 17:53784764-53784786 CTGTCGGTGGGTAGGGGGCAGGG + Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150091735 17:62332438-62332460 CTGGGGGTGGGCTGGGAGGAAGG + Intergenic
1151268210 17:72972926-72972948 CTGTGGTAGGTCAGGCAGGAAGG + Intronic
1151370292 17:73643344-73643366 GTGTGGGTGGATGGGTAGGAGGG + Intronic
1151986792 17:77548793-77548815 CAGTGGGTGGGTAGGGGGGCTGG + Intergenic
1152037299 17:77881212-77881234 CTGGGGGTGGTGGGGGAGGCTGG - Intergenic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152485058 17:80585445-80585467 CTTTGGGAGGTTAAGGCGGATGG - Intronic
1152596933 17:81242375-81242397 CTGTGGGTGGGATGGGAGGCTGG - Intergenic
1152851646 17:82639964-82639986 CTGTGTGTGGGTCGGGAGGGTGG + Intronic
1154091088 18:11364069-11364091 CTTTGGGTGGTCAAGGAGGGTGG - Intergenic
1154501753 18:15000916-15000938 CTGGGGGTGGGCAGGGCGGAGGG + Intergenic
1155510266 18:26569429-26569451 CTGTGAGTTGTCAGGAAGGAAGG - Intronic
1156787012 18:40927292-40927314 TTTTGGGTGGTAAGGGATGAAGG + Intergenic
1156812055 18:41264215-41264237 CAGTGGGTGGGTGGGGAGGGGGG + Intergenic
1157336426 18:46741856-46741878 CTTTGGGAGGCTAAGGAGGATGG + Intronic
1157418881 18:47528224-47528246 CTGTGGGTGGGTTAGCAGGATGG + Intergenic
1157476166 18:48024954-48024976 CTTTGGGAGGTTGAGGAGGAAGG - Intergenic
1158073617 18:53503006-53503028 CTGTCGGTGGGTAGGGTGAAGGG - Intronic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1160377669 18:78426133-78426155 CTGTGGGGGGTTGGGGGGGATGG - Intergenic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161206161 19:3042270-3042292 CTGTGGAGGGGCAGGGAGGAAGG + Intronic
1161502034 19:4621590-4621612 CTCTGGGTGCTTAGGCAGGTGGG - Intergenic
1161516494 19:4699527-4699549 CAGGGGGTGGCTACGGAGGAGGG + Intronic
1161770843 19:6230011-6230033 CTGGTGGTGGTTATGGAGGAGGG - Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163248357 19:16111277-16111299 CAGTGGGGGCCTAGGGAGGAAGG - Intergenic
1163648127 19:18501831-18501853 CTGCGGGTGGGCAGGAAGGAGGG + Intronic
1164476836 19:28582040-28582062 CTGGGGGTGGTGAGGGCGGGGGG - Intergenic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1165132979 19:33644824-33644846 AAGTGTGGGGTTAGGGAGGAAGG + Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165700085 19:37930826-37930848 CTGTTGGGGGTTGGGGGGGAGGG - Intronic
1165878465 19:39026177-39026199 ATGTGGTTGCTCAGGGAGGAGGG - Intronic
1166271842 19:41719323-41719345 CTGTGGGTGGATGGTGATGATGG - Intronic
1166803492 19:45471728-45471750 CTGTGGGTGGCTAGGGCAGGAGG - Intronic
1167245472 19:48370666-48370688 CTTTGGGAGGTTAAGGCGGAAGG - Intronic
1167483491 19:49746797-49746819 TCCTGGGTGGTAAGGGAGGACGG + Exonic
1167600454 19:50451604-50451626 CTGTAGGGTGTGAGGGAGGAGGG + Intronic
1168231216 19:55032790-55032812 CTGGGGGTGGTGGGAGAGGAGGG + Intronic
1168450747 19:56464718-56464740 TTGTGTGTGTTTAGGGAGGGGGG - Intronic
925021601 2:574002-574024 CGGTGGGTTTTCAGGGAGGAGGG - Intergenic
925318565 2:2943464-2943486 CTTTGGGAGGTCAAGGAGGACGG + Intergenic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925467045 2:4115450-4115472 CTGTCGGGGGTTGGGGAGCAAGG - Intergenic
926029710 2:9575551-9575573 TTGGGGGGGGTTGGGGAGGAGGG - Intergenic
926720805 2:15958798-15958820 CTATGGGTGGGTGGGGAGCAGGG - Intergenic
927605266 2:24481199-24481221 CTGTTGGTGGGGAGAGAGGATGG - Intergenic
927710810 2:25324740-25324762 CTGGGGATGGATAAGGAGGAGGG + Intronic
927754226 2:25695792-25695814 CTTTGGGAGGTTAAGGCGGAAGG - Intergenic
928997452 2:37308528-37308550 CTCTGGGTGGGGAGGGAGGTGGG - Intronic
929562067 2:42962216-42962238 CTGTGGGTGCCTTGGGAGGTGGG + Intergenic
930028979 2:47046959-47046981 CCGTGGGTGACTAGGGAAGAAGG - Intronic
930067069 2:47335797-47335819 CTGTTGGTGGGGTGGGAGGAGGG - Intergenic
930116121 2:47719822-47719844 CTGAGGCAGGATAGGGAGGAGGG + Intronic
930359883 2:50364084-50364106 CTGTTGGGGGTTGGGGAGCAAGG + Intronic
931162052 2:59703126-59703148 CTCTGGGTGCTTGGGGAGGAAGG - Intergenic
932233366 2:70101191-70101213 CTTTGGGAGGTCATGGAGGAAGG + Intergenic
932767516 2:74480935-74480957 CTGTGAGTGGCTGGGGAGTAGGG - Exonic
934211959 2:89988067-89988089 CTGTGGGAGTTTGGGTAGGAAGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934949836 2:98568789-98568811 GTGTGTGTGTTTAGGGAGAAAGG - Intronic
934982068 2:98850824-98850846 CTGTGGTCAGTTAGGGTGGAGGG - Intronic
935376758 2:102408053-102408075 CTGGGGGTTCTTAGGGAGGAGGG + Intergenic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
936957529 2:118038000-118038022 CTGTGAGAGGTTGGAGAGGAAGG - Intergenic
936971216 2:118178051-118178073 CTGTGGGTAGTTAGTGGGCAGGG - Intergenic
937098306 2:119249757-119249779 CTGTGGGTGGCAAAGGACGAGGG - Intronic
937144812 2:119635499-119635521 CTGTGGATGGGTTGGGTGGATGG + Intronic
938091503 2:128437521-128437543 CTGTGGGTGGCTGGGCAGGCCGG + Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938894184 2:135734469-135734491 CTTTGGGAGGTCAGGGAGGGGGG - Intergenic
938961591 2:136348663-136348685 CTGTGGATGCTTTGGGAGGTTGG + Intergenic
939901792 2:147859360-147859382 CTGTGTGTGATTAGAGAGGAGGG + Intronic
940667406 2:156625590-156625612 ATGTGGGGAGGTAGGGAGGAAGG + Intergenic
941698920 2:168582850-168582872 CTGTGGGTGCTTGGGAAGGATGG - Intronic
942076893 2:172364488-172364510 GTGAGGGTGGGTAGGCAGGATGG + Intergenic
942147190 2:173038581-173038603 CTGTCGGAGGTTGGGGAGCAAGG + Intronic
942401465 2:175608135-175608157 CTGGGGGAGGTTAGTGGGGATGG + Intergenic
943021685 2:182582093-182582115 AAGTGGATGGTTAGGGTGGAGGG - Intergenic
943548083 2:189306235-189306257 CAGTGGGTGATTAAGGACGATGG - Intergenic
944109289 2:196114694-196114716 CTGTCGGGGGGTAGGGAGCAAGG - Intergenic
944155556 2:196603835-196603857 CTGGGGGAGGTTGGAGAGGAGGG + Intergenic
944409121 2:199419877-199419899 CAGGGGGTGGATTGGGAGGAAGG - Intronic
944483646 2:200181384-200181406 GTGTGAGTGATTTGGGAGGAGGG - Intergenic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
946273774 2:218615450-218615472 CTGTGGGTTATTGGGTAGGAAGG + Intronic
946772627 2:223104511-223104533 CTGCGGGTGGTGAGGGAGAGAGG + Intronic
948668074 2:239548657-239548679 CTGAGGGTGGAGAGGCAGGAGGG + Intergenic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1171036873 20:21720189-21720211 CTTTGGGAGGTTGAGGAGGAAGG + Intergenic
1171954053 20:31446124-31446146 CTGTGGGTGGTTGGGGGCGCAGG + Intronic
1171993217 20:31712776-31712798 GTGTGTGTGGCCAGGGAGGAGGG + Intronic
1172803027 20:37591578-37591600 CTGTGTGGGTTTGGGGAGGAAGG - Intergenic
1173509669 20:43616775-43616797 CTTTGGGAGGTTAAGGAGGTAGG + Intronic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175027309 20:55915841-55915863 CTTTGGGTATTTGGGGAGGAAGG + Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175579139 20:60085825-60085847 CTGTGGGTGGTTGGGCAGTTAGG + Intergenic
1176314130 21:5225878-5225900 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1176387536 21:6146253-6146275 CTGTGTGGGGATAGGGAGGTCGG - Intergenic
1177496113 21:21894567-21894589 CTGTAGGTGGATATGGAGGATGG + Intergenic
1179354117 21:40642689-40642711 CTTTGGGTGGCTAGGGTGGGAGG - Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179735936 21:43391995-43392017 CTGTGTGGGGATAGGGAGGTCGG + Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180125480 21:45787498-45787520 CTGTGGGGGGCCAGGGCGGAAGG - Intronic
1180391942 22:12291997-12292019 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1180407802 22:12572759-12572781 CTGAGGTTTGGTAGGGAGGAAGG + Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180802197 22:18637146-18637168 CTGTGGGAGGATAGGGCGGTGGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181262536 22:21608823-21608845 CTGTGGGAGGCCAGGGAGGGAGG - Intronic
1181320757 22:22004318-22004340 CTGTGGGTGGGTAGGAAAGGGGG - Intergenic
1181694207 22:24584908-24584930 CTGATGGTGCTTGGGGAGGAAGG + Intronic
1183442323 22:37830239-37830261 CTGAGGTAGGTAAGGGAGGATGG - Intergenic
1183642698 22:39101728-39101750 CTGTGGGAGGCCAGGAAGGAAGG + Intronic
1183951501 22:41355446-41355468 CTGTGGGGGGATGGGGAGGGGGG - Intronic
1185063917 22:48621208-48621230 GTGTGGGTGGATTGGGTGGATGG - Intronic
949202535 3:1395970-1395992 ATTGGGATGGTTAGGGAGGAAGG - Intronic
949223764 3:1668997-1669019 CTGAAGGTAGTTAGGGAGGTGGG - Intergenic
950494241 3:13324235-13324257 CTGAGGGTGGACAGGGAGGAAGG - Intronic
950498534 3:13349195-13349217 GGGTGGGAGGTCAGGGAGGATGG - Intronic
950882640 3:16335619-16335641 CTGTTGGAGGTGTGGGAGGAGGG + Intronic
951657304 3:25023870-25023892 ATGTGGGTGTTTGGGGAGGTGGG + Intergenic
952277142 3:31887922-31887944 ATCTTGGTGGTTTGGGAGGATGG - Intronic
952845810 3:37686949-37686971 CTGTGGGTTGTTAAGCAGGTTGG - Intronic
953502539 3:43451598-43451620 GTGGTGGTGGTTAGGGATGAAGG + Intronic
953545878 3:43863328-43863350 CTTTGGGTGGCTGAGGAGGAGGG + Intergenic
953756261 3:45648259-45648281 CAGTGGTTGCTTAGGGATGAGGG - Intronic
954372365 3:50175511-50175533 CTCTGGGTGCTGAGTGAGGAAGG - Intronic
954425526 3:50440951-50440973 TTGTGGGTGGACAGGGACGAGGG + Intronic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
954829187 3:53404188-53404210 CTGTCGGGGGCTAGGGAGCAAGG - Intergenic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
955989633 3:64612580-64612602 CTGTGGCTGGTCAGGGTGAAGGG + Intronic
956060212 3:65341303-65341325 CACTGGGTTGATAGGGAGGATGG + Intergenic
956111267 3:65871819-65871841 CTGCGTGGGGTTAGGGAGAAAGG - Intronic
958825346 3:99022996-99023018 CTGTGTGTTGTTGGGGAGGTGGG + Intergenic
959858319 3:111187783-111187805 GGTTGGGTGGCTAGGGAGGATGG + Intronic
960052662 3:113252828-113252850 CTGTGAGTGCTCAGGGAGGGAGG + Intronic
960293169 3:115911585-115911607 CTCTGGGAGGTCAAGGAGGATGG - Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961673074 3:128548944-128548966 CTGTGGGTGTCAAGGAAGGAGGG - Intergenic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962412964 3:135157358-135157380 CTTGGGCTGGTTTGGGAGGAAGG - Intronic
962939779 3:140115396-140115418 CTGTGGGTGGGTGGGTAGGTGGG + Intronic
963480977 3:145874343-145874365 CTGTTGGGGGATAGGGAGAAAGG - Intergenic
963845828 3:150157016-150157038 TTGCTAGTGGTTAGGGAGGAGGG + Intergenic
964033289 3:152164968-152164990 CTGAAGGTGGTTAGGGAATAAGG + Intergenic
964542646 3:157796718-157796740 CTGTGGGTGAGTATGGTGGAAGG - Intergenic
964812108 3:160676663-160676685 CTGTATGTGATTAGGGAGTAAGG + Intergenic
964853972 3:161125551-161125573 CTTTGGGAGGTCAGGGAGGGAGG + Intronic
966049047 3:175590901-175590923 GTGTGTGTGCTTAGGGATGAAGG + Intronic
967798768 3:193630204-193630226 CTGTGTGTGTTTATGCAGGATGG - Intronic
968057291 3:195701969-195701991 CTGTGGGTGGCTGGGGTGGACGG + Intergenic
968486129 4:863424-863446 CAGTGGCAGGTTTGGGAGGACGG + Intronic
968695626 4:2024760-2024782 CTGTGGTTGGTTAGGAAGTCTGG + Intronic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
968967290 4:3775580-3775602 CTGTGGGAGGTCAGGGGGGTGGG - Intergenic
969914398 4:10475576-10475598 CTTTGGGAGGCCAGGGAGGACGG + Intergenic
972472542 4:39420909-39420931 TGGTGTGTGGTTAGGGAGTAAGG - Intronic
972671787 4:41219501-41219523 ATGCGGGTGGTTGAGGAGGAAGG - Intergenic
972691500 4:41403202-41403224 CTGGGGGTGGTGGGGGAAGATGG + Intronic
972852863 4:43072061-43072083 CTGGGGGTGGGTAGGGAGTTAGG + Intergenic
973337908 4:48975098-48975120 CTCAGTGTGGTTAGTGAGGATGG + Intergenic
973339531 4:48989665-48989687 CTGTGGGAGGCCAGGGAGAATGG - Intronic
975073229 4:70170119-70170141 GTGTGGGTGTGTGGGGAGGAGGG + Intronic
975259692 4:72283290-72283312 CTCTTGGTGGGTGGGGAGGATGG + Exonic
975966104 4:79973980-79974002 CTGTGGTTGGTTTGGTTGGATGG + Intronic
976178666 4:82379032-82379054 ATGTGGGGGGTGAGGGAGGGGGG - Intergenic
976409562 4:84698027-84698049 GTGTGTGTGGTTGAGGAGGAAGG - Intronic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
977167168 4:93714086-93714108 CTGTTGGGGGTGGGGGAGGAAGG - Intronic
978203884 4:106056346-106056368 CTATGGGAGGCTAAGGAGGAAGG - Intronic
978359851 4:107919318-107919340 CTTTGGGAGGTTAAGGTGGATGG + Intergenic
980104901 4:128578325-128578347 CTGTGGGTAGCTAGGGGGCATGG - Intergenic
980796013 4:137684069-137684091 CTGTGGGAGGCTAGGGCGGGCGG - Intergenic
981594432 4:146403336-146403358 CTATAGGTGGTTATGGAGTATGG - Intronic
982013023 4:151125222-151125244 CTTTGGGAGGTTGGGGCGGATGG + Intronic
982246603 4:153358952-153358974 GTGTGCGTGGTGAGGGAGAAAGG - Intronic
982253660 4:153432165-153432187 CTGGGGGTGCTGAGGAAGGAGGG + Intergenic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
984117749 4:175703412-175703434 CTTTGGGAGGCTAGGGTGGATGG - Intronic
984498440 4:180528959-180528981 TTGTGTGTGGGTAGGGTGGAGGG - Intergenic
984691852 4:182735084-182735106 CTGTAGGTTGTTAGGGTGAATGG - Intronic
984806808 4:183758646-183758668 CTATGGAATGTTAGGGAGGAAGG - Intergenic
984830188 4:183965851-183965873 AAGGGGGTGGTTAGGGAAGAAGG + Intronic
985339674 4:188936046-188936068 CTTTGGGAGGTTAAGGAGGCAGG - Intergenic
985432984 4:189899474-189899496 CTGAGGTTTGGTAGGGAGGAAGG + Intergenic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
986709871 5:10480871-10480893 CTGTGGGTGGGCAGGGAGCTAGG - Intergenic
987348941 5:17004266-17004288 GTGTGGGTGTTTGGGGAGGGGGG - Intergenic
988053659 5:26063156-26063178 CTTTGGGAGGTTGGGGAGGGTGG - Intergenic
988561178 5:32282767-32282789 GTTTGGGTGGGTAGGAAGGACGG + Intronic
989552556 5:42752767-42752789 CTGTGGGTGGCTGGGCATGATGG - Intergenic
990970246 5:61497994-61498016 CTGTGGGGGTCTAGGGATGAGGG + Intronic
992706537 5:79400598-79400620 CTTTGGGAGGCTAAGGAGGATGG - Intronic
992778217 5:80106191-80106213 CTCTGGGTGGTGAGGGGGTAGGG - Intergenic
993002462 5:82395548-82395570 CTGGGGGTGGTAATGGAGGTGGG - Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993766161 5:91861398-91861420 CTGTCGGGGGTTAGGGAGTAAGG + Intergenic
993957187 5:94248636-94248658 GTGAGGTGGGTTAGGGAGGAAGG + Intronic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
995063750 5:107838470-107838492 CTTTGGGAGGTTAAGGAGGGAGG + Intergenic
995666687 5:114550430-114550452 CTGTTGGGGGTTGGGGAGCAAGG + Intergenic
995733771 5:115274984-115275006 CTCTGGGAGGTTAAGGCGGATGG - Intronic
995785433 5:115822713-115822735 CTGTGGGTGGGTTGGGGGCAAGG - Intergenic
996059525 5:119017753-119017775 CTTTGGGAGGTGATGGAGGAGGG + Intergenic
996408035 5:123125998-123126020 GTGTGGGTGGGTTGGGGGGAGGG + Intronic
997046139 5:130320445-130320467 CTGTGGTTGGGTAGGGGAGAGGG + Intergenic
997249744 5:132379412-132379434 CTTTGGGAGGTTATGGAGGGAGG - Intronic
997445278 5:133935727-133935749 CAGTGGGGGTTTGGGGAGGAGGG - Intergenic
997631637 5:135373196-135373218 CCGTTGGTGGTCGGGGAGGAGGG + Intronic
997949972 5:138234648-138234670 CTGTGGGAGGTCAGTGAGGATGG + Intergenic
999742687 5:154568549-154568571 CTGGGGGTGGGAGGGGAGGAGGG + Intergenic
1001365166 5:171130216-171130238 CGGTGGGTGGTTAGTGATGGGGG - Intronic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1001790636 5:174454745-174454767 CTGTGTGTGTTTATGGAGCAGGG - Intergenic
1002095413 5:176828078-176828100 CTGGGGGTGGGTGTGGAGGAGGG - Intronic
1002435095 5:179226518-179226540 CTGTGGGAGGCCAGGGTGGATGG - Intronic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1002992476 6:2250690-2250712 CTGTGGGTGGCCAAGGAGGGAGG - Intergenic
1003954005 6:11145486-11145508 CTGTGAGGGGTAAGGAAGGAAGG + Intergenic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004163204 6:13232748-13232770 CTGAGGGTGGTTGGGGTGGGTGG + Intronic
1004164962 6:13249004-13249026 CTGTGGCTGGCAAGGGAGGACGG - Intronic
1004876773 6:19963739-19963761 CTGGGGGTGGCTAGGGAACATGG - Intergenic
1006067320 6:31471474-31471496 CTTTGGGGGCTTAGGAAGGAAGG + Intergenic
1006134059 6:31885017-31885039 CTGTGGGTGGGAAGGGAGTGAGG + Intronic
1006154203 6:32005556-32005578 CTGTGGGTGGGTCGGTGGGAAGG + Intergenic
1006175240 6:32117451-32117473 CTGTGGGTGGGCAAGGAGGGTGG - Intronic
1006333927 6:33410879-33410901 CTGTTGGAGGTGAGGGAGGTGGG + Intronic
1006400446 6:33814366-33814388 CTGTTGGTGGTAAAGGAGGTTGG + Intergenic
1006486823 6:34349664-34349686 TAGTGGGTGGATAGGGAGAAAGG - Intronic
1006942686 6:37763353-37763375 GTGTGGGTGGTAAGGGAAGAGGG + Intergenic
1007342661 6:41201310-41201332 CTGGGGGAGGTTGGGGAGGGCGG - Intergenic
1007609687 6:43141552-43141574 CTGTGGGTGGTCAGGAGCGATGG + Intronic
1008883832 6:56410564-56410586 CTGAGCGGGGTGAGGGAGGAGGG - Intergenic
1009459323 6:63893570-63893592 CTGTTGGTGGTTGGGGGGCAAGG + Intronic
1010717352 6:79244963-79244985 GGGTGGGAGGGTAGGGAGGATGG + Intergenic
1011032679 6:82940675-82940697 CTGAGAGTGGGTAGGGAAGAAGG - Intronic
1011218682 6:85032071-85032093 CTGTGAGTGTTAGGGGAGGAGGG - Intergenic
1011661563 6:89599127-89599149 CTTTGCGTGGCTATGGAGGAAGG + Intronic
1013005190 6:106066090-106066112 CAATGGGTGGTTAGGCAGGGCGG - Intergenic
1013325794 6:109045696-109045718 CTTTGGATGGTTGGGGATGAGGG - Intronic
1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG + Intergenic
1013471981 6:110474171-110474193 CTGTGGTGGGGTCGGGAGGATGG - Intronic
1013809358 6:114027089-114027111 CTGTGGGTTGTTTGAGAGCAAGG + Intergenic
1013819299 6:114135594-114135616 CCCTGGGTGGAGAGGGAGGATGG - Intronic
1014219676 6:118787381-118787403 CTTTGGGAGGTTAAGGAGGGAGG + Intergenic
1015037208 6:128670132-128670154 CTGAGGGTGGTGATGGTGGATGG + Intergenic
1017510796 6:155112887-155112909 GTGGGGGTGGTAAGGGAGGGGGG - Intronic
1017689420 6:156948409-156948431 CAGTGGGTGGTGGGGGTGGAGGG + Intronic
1017861153 6:158398403-158398425 CAGTGGGTGGGTGAGGAGGAGGG - Intronic
1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG + Intronic
1018060605 6:160086879-160086901 GTGTGTGTGGTCAGGGTGGAAGG + Intronic
1018269319 6:162058707-162058729 CTTTGGGTGGCTGAGGAGGATGG + Intronic
1019197561 6:170291162-170291184 TTTTGTGTGGTGAGGGAGGAAGG - Intergenic
1019328365 7:450789-450811 CTGTGGGTGGGTTGGGGGGTGGG - Intergenic
1019479855 7:1261422-1261444 CAGGGGATGGTTTGGGAGGATGG + Intergenic
1019527599 7:1487694-1487716 CTGTGGGTGGTTGGTGTGGGTGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020568299 7:9824697-9824719 CTGTTGGGGGTGAGGGATGAGGG - Intergenic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1022580912 7:31553225-31553247 CTGTGAGTGGTGAGGGATGTGGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022681917 7:32556734-32556756 CTGTGGCTGGATAGTGATGATGG - Intronic
1022829991 7:34056231-34056253 CTGTTGGGGGGTAGGGTGGAGGG + Intronic
1023201078 7:37697576-37697598 CTGTGGTGGTTTAGGAAGGAGGG + Intronic
1024760200 7:52586980-52587002 GTGTGAGAGGTTAGGGAAGATGG + Intergenic
1025072804 7:55915699-55915721 CTGTGGTTGGTGTGGAAGGAGGG + Intronic
1025212573 7:57028687-57028709 CTGGGGGTGGGCAGGAAGGAGGG - Intergenic
1025659380 7:63548140-63548162 CTGGGGGTGGGCAGGAAGGAGGG + Intergenic
1026212730 7:68321204-68321226 CTGGAGGTGGTGAGGGAGAATGG - Intergenic
1026390697 7:69898648-69898670 CTGTGTGTGGTTGGGGATGAGGG - Intronic
1027049833 7:75015026-75015048 CAGTGGGTGGCTAGAGAGGCAGG - Intronic
1027529481 7:79312887-79312909 CGGTGGGTGGAGGGGGAGGAGGG - Intronic
1028504664 7:91557857-91557879 TTGGGGGTGGGTGGGGAGGAGGG - Intergenic
1029383201 7:100226638-100226660 CAGTGGGTGGCTAGAGAGGCAGG + Intronic
1029675715 7:102067139-102067161 CTGGGGGTGGGTGGGAAGGAGGG - Intronic
1029870982 7:103692494-103692516 TTGGGGGTGGTGAGTGAGGAGGG + Intronic
1030652176 7:112128022-112128044 CTGTCGGGGGTGAGGGTGGAGGG + Intronic
1031717094 7:125123100-125123122 CTGTCGGGGGTTAGGGGGAAGGG - Intergenic
1032214997 7:129951337-129951359 CGGTGGGGGGATGGGGAGGAGGG + Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032700613 7:134375284-134375306 ATGCGGGTGGCTGGGGAGGATGG + Intergenic
1033080368 7:138290946-138290968 CTTTGGGAGGCTAAGGAGGATGG - Intergenic
1033453520 7:141482301-141482323 AGGTGGGTGTTCAGGGAGGAAGG - Intergenic
1033789400 7:144773447-144773469 CTGTGGGTGGTCAAGGTAGAAGG + Intronic
1034350080 7:150409717-150409739 CTGGGAGTGGTTTGGGAGGAAGG + Intronic
1035286899 7:157812386-157812408 ATGAGGGAGGTGAGGGAGGAGGG + Intronic
1036089770 8:5652982-5653004 ATGTGGGTGGTGAGGAATGATGG + Intergenic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1037147004 8:15584701-15584723 GTGGGGGTGGTGAAGGAGGAGGG + Intronic
1038027236 8:23602615-23602637 CTTTGGGAGGTCGGGGAGGATGG - Intergenic
1038415291 8:27390389-27390411 CTTTGGGAGGTTGAGGAGGAAGG + Intronic
1038454898 8:27666821-27666843 CTGAGCTTGGATAGGGAGGAGGG - Intronic
1038491929 8:27977628-27977650 CTGGGGGTTTTTAGGGAGGAAGG - Intronic
1038509285 8:28115854-28115876 CTGAGGGTGGTAGGGAAGGAGGG - Intronic
1039130727 8:34261468-34261490 CTTTGGGAGCTTGGGGAGGAAGG - Intergenic
1039273949 8:35914279-35914301 CTGTCGGTGGGTAGGGGGTAAGG + Intergenic
1039442223 8:37603000-37603022 CTGTGGGTGCTGTGGGAGCAAGG - Intergenic
1041309524 8:56501244-56501266 TTCTGGGTGGTTAAGGAGGAAGG + Intergenic
1041411512 8:57561365-57561387 CTGGGGCTGGTTCTGGAGGAGGG - Intergenic
1041763104 8:61387976-61387998 CTGTGGGTAGATACCGAGGAGGG + Intronic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1044551071 8:93512989-93513011 CAGAGGGTGGGAAGGGAGGAGGG + Intergenic
1045116239 8:98984240-98984262 CTTTGGGTGGTCAAGGTGGAAGG + Intergenic
1045282583 8:100761881-100761903 CTGTGGGATGCTTGGGAGGAAGG - Intergenic
1046193282 8:110827512-110827534 ATGTGTGTGGTGTGGGAGGAGGG - Intergenic
1047157536 8:122337594-122337616 CGGTGGGTGGTGGGGGAAGATGG + Intergenic
1047198108 8:122740115-122740137 CTGGGGGTGGTGGGGGAGGGAGG - Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1047792940 8:128223471-128223493 TTGTGGGTGATTAAGGATGATGG - Intergenic
1048577769 8:135706444-135706466 CTGTGTGTAGTTTGGGAGGTAGG - Intergenic
1048648913 8:136453065-136453087 TTGTCAGTGGGTAGGGAGGATGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049164942 8:141119801-141119823 GTGTGCTTGGTCAGGGAGGAAGG - Intronic
1049504880 8:142991004-142991026 CTGTGGGTGGTTAGAGGCCATGG - Intergenic
1049569862 8:143364338-143364360 CTGAGTGTGCTTAGGGAGGGAGG - Intergenic
1049575970 8:143389773-143389795 CTGTGTGTGGTCAGGGAGCCAGG - Intergenic
1049577384 8:143396009-143396031 GTGTGGGGAGTTAGGGAGGAGGG + Intergenic
1050143254 9:2538637-2538659 CTGTGGGGAGGTGGGGAGGAGGG - Intergenic
1051154231 9:14123003-14123025 CTGTGGGAGGTCAGGGTGGGTGG + Intronic
1051560696 9:18437540-18437562 GTGGGGGTGGTTAGGAAGGCAGG - Intergenic
1052549559 9:29930630-29930652 CTGTGGGAGGCTAAGGAGGGTGG + Intergenic
1052721349 9:32174773-32174795 ATCTGGATGATTAGGGAGGAAGG - Intergenic
1052835488 9:33246924-33246946 CTGGTGGTGGATAGGGAGTAGGG + Intronic
1052935527 9:34089778-34089800 CAGTGTGTGGATAGGCAGGATGG - Intronic
1053010473 9:34630004-34630026 CTGTGGGTGGCCAGGGTGGGTGG - Intergenic
1053235705 9:36451971-36451993 CTTTGGGAGGCCAGGGAGGATGG + Intronic
1053466732 9:38313977-38313999 CTGTTGGGGGTTAGAGAGCAAGG - Intergenic
1056077807 9:83059604-83059626 GTGTGGGTGTTGAGGGTGGAGGG - Intronic
1056108515 9:83371766-83371788 CTCTGTCTGGTTAGTGAGGAAGG - Intronic
1056670167 9:88620756-88620778 CTGTGGGAGGCTATGGATGAAGG + Intergenic
1057159978 9:92882637-92882659 CTGGGGGTGTTTAGCGATGAGGG - Intergenic
1057355553 9:94328423-94328445 GAGTCTGTGGTTAGGGAGGAGGG - Intronic
1057503559 9:95614976-95614998 CTGTGGGTGCTTATGCAGGGAGG + Intergenic
1057652203 9:96929199-96929221 GAGTCTGTGGTTAGGGAGGAGGG + Intronic
1059706740 9:116830964-116830986 CTGTGGGTGGGTGGGGAGAAGGG - Intronic
1059729129 9:117039423-117039445 CTGTTGGGGGTTGGGGAGAAAGG + Intronic
1060104650 9:120866097-120866119 CTGTGGGTGGGTAGAGACGGGGG + Intronic
1060193307 9:121606721-121606743 CAGTGGGGGGTGAGGGAGGTGGG + Intronic
1060686418 9:125617808-125617830 CTGTGAGTGGTCAGGGAGCAAGG + Intronic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1061393446 9:130330398-130330420 CTGTAGGTGGTTGGGGTGGATGG + Intronic
1061420817 9:130472094-130472116 CTGTGGGAGGTGGGGGAGGCAGG + Intronic
1061520471 9:131114631-131114653 TTGAGTGTGTTTAGGGAGGAGGG + Intronic
1062498736 9:136843432-136843454 CTGGGGGTGGGCAGGGCGGAGGG - Intronic
1062612338 9:137380645-137380667 CAGAGGGGGGTTGGGGAGGAGGG - Intronic
1203453035 Un_GL000219v1:138451-138473 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1185528693 X:799861-799883 CTTTGGGAGGTCAGGGTGGATGG - Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1187760778 X:22581539-22581561 CTGTGGGTGGGTTGGGGGCAAGG + Intergenic
1188875771 X:35428325-35428347 GGGTGGGAGGGTAGGGAGGATGG + Intergenic
1189537119 X:41946880-41946902 CTGAGGGTTGTGAGGGAGAAAGG + Intergenic
1190630899 X:52384847-52384869 CTGTTGTTGGGTGGGGAGGAGGG + Intergenic
1192264911 X:69531400-69531422 CTGTGTGGGGTTGGGGAGTAGGG + Exonic
1192451256 X:71246452-71246474 CTGGGGGTGGTGGGGGTGGAGGG + Exonic
1193646111 X:84070388-84070410 CTGTCGGGGGTTAGGGAGAAGGG + Intronic
1193821551 X:86171361-86171383 CTGGGGGTGGTTGCGGGGGAAGG - Intronic
1195919784 X:109972075-109972097 GTGTGGGGGGTTAGGGGGGCGGG + Intergenic
1196052551 X:111321021-111321043 CTGATGGAGGCTAGGGAGGAGGG + Intronic
1196398210 X:115288579-115288601 CCGGGTGTGGTGAGGGAGGAAGG + Intergenic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1196927969 X:120652630-120652652 CTGTCGGTGGGTAGGGGGCAAGG + Intergenic
1197197995 X:123722562-123722584 CTGTTGGGGGTTGGGGAGCAAGG + Intronic
1197854764 X:130902979-130903001 CTGAGGGGGCCTAGGGAGGAGGG - Intronic
1198034033 X:132783524-132783546 GTGTGGGTGGGTAGAGATGAAGG - Intronic
1198096596 X:133385961-133385983 ATGTGGGGGCCTAGGGAGGAGGG + Intronic
1198857769 X:141035917-141035939 CTTTGGGAGGTCAGGGTGGATGG - Intergenic
1198904927 X:141551454-141551476 CTTTGGGAGGTCAGGGTGGATGG + Intergenic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1201226467 Y:11823562-11823584 CTGCTGCTGGTGAGGGAGGAAGG + Intergenic
1201324345 Y:12738781-12738803 CTTTGGGGGGCTAAGGAGGATGG - Intronic
1201364769 Y:13191672-13191694 CTTTGGGAGGCTAAGGAGGATGG + Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic