ID: 1001563228

View in Genome Browser
Species Human (GRCh38)
Location 5:172683647-172683669
Sequence CAGTAGCGCCGGCGACGACG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001563228_1001563235 10 Left 1001563228 5:172683647-172683669 CCGCGTCGTCGCCGGCGCTACTG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1001563235 5:172683680-172683702 TGCGCTTCCACGCAACACGCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1001563228_1001563234 9 Left 1001563228 5:172683647-172683669 CCGCGTCGTCGCCGGCGCTACTG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1001563234 5:172683679-172683701 CTGCGCTTCCACGCAACACGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1001563228_1001563237 29 Left 1001563228 5:172683647-172683669 CCGCGTCGTCGCCGGCGCTACTG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1001563237 5:172683699-172683721 CGGGCCCGACGTGAGCCTGTCGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001563228 Original CRISPR CAGTAGCGCCGGCGACGACG CGG (reversed) Exonic
900364806 1:2306781-2306803 CCGCAGCGCCGCCGACAACGCGG + Exonic
903514737 1:23902841-23902863 CAGCAACGCCGGCGCCGCCGTGG - Intronic
906640319 1:47437594-47437616 CAGGAGCGGCGGCGAAGACAAGG + Exonic
919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG + Exonic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1075430159 10:122373901-122373923 CAGTAGCGGTGGCGGGGACGGGG - Intergenic
1079071541 11:17351956-17351978 CAGCAGCCGCGGCGATGACGTGG + Exonic
1085666234 11:78417699-78417721 CATGAGCGGCGGCGGCGACGTGG - Exonic
1092564205 12:9647962-9647984 CAGAAGCGCCGGCGGCTGCGGGG + Intergenic
1106533531 13:30617747-30617769 CAGTTGCGACTGCGGCGACGAGG - Intronic
1108373449 13:49792653-49792675 CAGTAGCGCCGGGGGAGGCGCGG + Exonic
1113379060 13:109786486-109786508 CAGCAGCCCCGGCGGCGGCGCGG - Exonic
1118186544 14:63543136-63543158 CGGCGGCGGCGGCGACGACGTGG + Exonic
1122993283 14:105248924-105248946 CAGCAACGCCGGCGCCGCCGTGG + Exonic
1125709698 15:41774780-41774802 CGCTAGCGCCGGCGGGGACGCGG - Intronic
1127488185 15:59438230-59438252 CAGCCGCGCCGGCGAGGACATGG + Exonic
1132560072 16:589597-589619 CAATGGCGCCGGCGACGGGGCGG + Intronic
1147150224 17:38510054-38510076 CAGCAGCACCGACGACGACTCGG + Exonic
1151478543 17:74356878-74356900 CAGCAGCGGCGGCGACGCGGCGG - Exonic
1151941915 17:77298010-77298032 CAGTAGAGCAGGCGAGGAGGAGG + Intronic
1152649828 17:81487776-81487798 CAGAAGCGCCGGCTGAGACGTGG - Intergenic
1159369853 18:67516481-67516503 CCGTAGCGCGGGAGACGACGCGG - Exonic
1160860636 19:1236020-1236042 CAGTAGCCCTGACGACGTCGTGG - Exonic
932562777 2:72887546-72887568 CCTTAGCGCCCGCAACGACGAGG + Exonic
932837313 2:75049659-75049681 CATCAGCGCCGGCGACTATGAGG - Exonic
947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG + Exonic
947820394 2:233064964-233064986 CAGTAGCTCTGGCTACGACCTGG - Intronic
1173792115 20:45834368-45834390 CACCAGCGCCGAGGACGACGAGG + Exonic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
998116743 5:139543541-139543563 CAGCTGCCCCGGCGACGACACGG + Intronic
998200488 5:140114307-140114329 CAGTGGCGGCGGCGGCGGCGGGG + Exonic
1001563228 5:172683647-172683669 CAGTAGCGCCGGCGACGACGCGG - Exonic
1005810993 6:29516338-29516360 TAGTAGTGCCGGCGAGGATGTGG + Intergenic
1018952619 6:168389042-168389064 CAGTAGCTCCGGCTGCTACGGGG + Intergenic
1023405882 7:39833523-39833545 CGGTAGCGGCGGCGGCGGCGAGG + Intergenic
1034222997 7:149460171-149460193 CAGTAGCGGCGGCGACTCCGGGG - Intronic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG + Intronic
1062406713 9:136400147-136400169 CAGTCGCCCGGGCGACGGCGGGG - Intergenic
1189310435 X:40014123-40014145 CAGGAGAGGCGGCGACGGCGGGG - Intergenic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1190984478 X:55488693-55488715 CAGCAGCGGCGGCGACGAGAAGG - Exonic
1196477742 X:116108465-116108487 CAGTGGCGCCGGTGAGGACAAGG - Intergenic