ID: 1001563308

View in Genome Browser
Species Human (GRCh38)
Location 5:172684009-172684031
Sequence CCCGGCGGCGACGTGCTCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001563302_1001563308 13 Left 1001563302 5:172683973-172683995 CCGAGCGGCGGCGACGCGCTCAG 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1001563308 5:172684009-172684031 CCCGGCGGCGACGTGCTCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 54
1001563301_1001563308 18 Left 1001563301 5:172683968-172683990 CCGTGCCGAGCGGCGGCGACGCG 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1001563308 5:172684009-172684031 CCCGGCGGCGACGTGCTCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 54
1001563300_1001563308 19 Left 1001563300 5:172683967-172683989 CCCGTGCCGAGCGGCGGCGACGC 0: 1
1: 0
2: 0
3: 12
4: 73
Right 1001563308 5:172684009-172684031 CCCGGCGGCGACGTGCTCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 54
1001563299_1001563308 24 Left 1001563299 5:172683962-172683984 CCGGGCCCGTGCCGAGCGGCGGC 0: 1
1: 0
2: 1
3: 10
4: 188
Right 1001563308 5:172684009-172684031 CCCGGCGGCGACGTGCTCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001563308 Original CRISPR CCCGGCGGCGACGTGCTCCT GGG Exonic