ID: 1001563510

View in Genome Browser
Species Human (GRCh38)
Location 5:172685213-172685235
Sequence CCACTGATTAAACCAGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001563510_1001563512 15 Left 1001563510 5:172685213-172685235 CCTGACACTGGTTTAATCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 124
Right 1001563512 5:172685251-172685273 CAGCTGTTGCTGTCTTCATGAGG 0: 1
1: 0
2: 1
3: 21
4: 208
1001563510_1001563514 22 Left 1001563510 5:172685213-172685235 CCTGACACTGGTTTAATCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 124
Right 1001563514 5:172685258-172685280 TGCTGTCTTCATGAGGGCAGAGG No data
1001563510_1001563515 25 Left 1001563510 5:172685213-172685235 CCTGACACTGGTTTAATCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 124
Right 1001563515 5:172685261-172685283 TGTCTTCATGAGGGCAGAGGAGG 0: 1
1: 0
2: 2
3: 23
4: 317
1001563510_1001563513 16 Left 1001563510 5:172685213-172685235 CCTGACACTGGTTTAATCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 124
Right 1001563513 5:172685252-172685274 AGCTGTTGCTGTCTTCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001563510 Original CRISPR CCACTGATTAAACCAGTGTC AGG (reversed) Intronic
903087841 1:20879441-20879463 CAACTGATGAAGCAAGTGTCAGG - Exonic
903529990 1:24022774-24022796 TCACTGCTTTAACTAGTGTCTGG + Intergenic
908203943 1:61825698-61825720 CCAATTATTATACCAGTGCCTGG - Intronic
909494536 1:76263779-76263801 TCACTTATTAAACCAAAGTCAGG + Intronic
915896334 1:159813994-159814016 CCTCTGGTTTAAACAGTGTCAGG + Intronic
918922230 1:190727744-190727766 ACACTGACTATACCAGTGTTTGG + Intergenic
919721219 1:200838537-200838559 TCAGTGTTTAAAACAGTGTCTGG - Intronic
1072388182 10:94954330-94954352 CACCTGATTAAACCAATCTCTGG + Intronic
1073992554 10:109279333-109279355 CCACCTAATAAGCCAGTGTCTGG - Intergenic
1074236799 10:111592786-111592808 CCCATGATTAAACCAGTGCCTGG - Intergenic
1075878628 10:125829277-125829299 TGACTGCTTAAAACAGTGTCTGG + Intronic
1078099697 11:8322632-8322654 CAACACATTGAACCAGTGTCTGG - Intergenic
1080257935 11:30313235-30313257 TCACTGTCTAAACCAGTGTAAGG + Intergenic
1083944887 11:65918268-65918290 CCACAGTTTAATCCAGTGCCTGG - Intronic
1085411456 11:76293136-76293158 CCACTGATTAGAACAGGGCCAGG + Intergenic
1085798293 11:79563982-79564004 CCATTTATCAAGCCAGTGTCAGG + Intergenic
1089166431 11:116480936-116480958 CCAGTGCTTAGATCAGTGTCTGG - Intergenic
1094043781 12:26145391-26145413 GCTCTGATTCATCCAGTGTCAGG + Intronic
1097338312 12:58409409-58409431 CCACTCATTAAGCCAGTGTTAGG - Intergenic
1098697856 12:73581751-73581773 CCACTGCTTAAACCCCTGTGGGG - Intergenic
1098731582 12:74042012-74042034 CAAGTGCTTAAAACAGTGTCTGG - Intergenic
1099396837 12:82150654-82150676 ACACTGATTAAAGCACTGTATGG - Intergenic
1099996465 12:89784701-89784723 CTACTGACTAAAGGAGTGTCTGG + Intergenic
1100118509 12:91340127-91340149 CCAATGTTTAGAACAGTGTCTGG - Intergenic
1101598403 12:106188113-106188135 ACAGTGATTAAAACAGTGGCTGG + Intergenic
1101697058 12:107136560-107136582 CCAGTGCCTAAAACAGTGTCTGG - Intergenic
1102479076 12:113208524-113208546 TCACTGATGTAACCAGTCTCTGG - Intronic
1103401919 12:120649115-120649137 CCCCTGATTAAACCATTGCGTGG + Intronic
1108556783 13:51601342-51601364 AAACAGATTAACCCAGTGTCTGG - Intronic
1109201596 13:59437303-59437325 ACACTAATTAAACCACTGTTTGG - Intergenic
1112836686 13:103523359-103523381 TTAGTGATTAAAGCAGTGTCAGG + Intergenic
1115504907 14:34084584-34084606 CCAGTGATTAGACCAGGGGCTGG - Intronic
1117253850 14:53958583-53958605 CCACTGATTAAAACAGGGCAGGG + Intronic
1117499597 14:56338823-56338845 CCACTGACTAAGCTAGTATCTGG + Intergenic
1118571802 14:67201586-67201608 CCACTGCTGAAACCAGTCACTGG + Intronic
1118922518 14:70162636-70162658 TCACTCATTAAACAAGTGACTGG - Intronic
1120551162 14:85874893-85874915 CCACATATTAAACCTGTATCTGG - Intergenic
1124960778 15:34392274-34392296 ACACAGATTAAAGCAGAGTCTGG + Intronic
1124977407 15:34538495-34538517 ACACAGATTAAAGCAGAGTCTGG + Intronic
1127777532 15:62277835-62277857 CCACAGATTAAAGCAGAGTCTGG + Intergenic
1128171700 15:65519101-65519123 CCGCTGCTTAAAACAGTGACAGG - Intergenic
1130089190 15:80805159-80805181 GCACTGATAAAATCAGTGGCTGG + Intronic
1133519257 16:6541364-6541386 CCTCTGTTTAGAACAGTGTCTGG - Intronic
1134034233 16:11017277-11017299 CCACTGTCTAATCCAGTGTCTGG - Intronic
1135467126 16:22696527-22696549 CAACTGCTTAGAACAGTGTCTGG - Intergenic
1135925180 16:26687737-26687759 ACACTGCTTAAAACAGTGTCTGG + Intergenic
1137841882 16:51648660-51648682 ACAAGGATGAAACCAGTGTCTGG + Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1138903648 16:61304046-61304068 CCATTAATTAAAACAGTGCCCGG + Intergenic
1140668090 16:77246266-77246288 CCACTGATTAAGCAACTGTATGG + Intergenic
1143893817 17:10121580-10121602 CCAGTGCTTAGGCCAGTGTCTGG + Intronic
1146017310 17:29244348-29244370 CCACTGATGAAACTTGAGTCGGG + Intergenic
1149491634 17:57089110-57089132 CCACTGAATAAACCAAGATCTGG - Intronic
1151248646 17:72816285-72816307 CCAATGATCAAAGCTGTGTCTGG - Intronic
1155571507 18:27199304-27199326 CCACTGATTAAACCTCTCTAGGG - Intergenic
1157891944 18:51426405-51426427 CTACTGATTAAACTTGGGTCTGG - Intergenic
1166214889 19:41328351-41328373 ACACTGTTTGAATCAGTGTCTGG + Intronic
926418727 2:12676124-12676146 TCACTAATTAATCAAGTGTCAGG + Intergenic
927587505 2:24320661-24320683 GCACTGATCACACCACTGTCTGG + Intronic
931569359 2:63652028-63652050 TCACTGATTAAACCAGACTGTGG - Intronic
933139601 2:78777603-78777625 CCAGTGCTTAGAACAGTGTCTGG - Intergenic
940042674 2:149377060-149377082 CCACTGTCTTAACCAGGGTCTGG + Intronic
941087363 2:161133477-161133499 CCACGGATTAAACAAGTGAAAGG - Intergenic
942037089 2:172020587-172020609 CCAATGACTAGAACAGTGTCTGG - Intronic
943709154 2:191070922-191070944 CGACTGCTTAAAACAGTGCCTGG + Intronic
946134998 2:217638260-217638282 GTACTGATTCATCCAGTGTCTGG + Intronic
946705947 2:222459034-222459056 CCACTGATTCAGCCAGTCTTGGG + Intronic
947644378 2:231727515-231727537 CCACCGCTTAGAACAGTGTCTGG + Intergenic
948602263 2:239114077-239114099 CCACTGAATGAATCAGTGTGGGG - Intronic
1173955621 20:47030348-47030370 CCACTGTGTAAACCAGTGGTTGG - Intronic
1174008422 20:47428849-47428871 CCACTGATGTACCCAGTGCCTGG + Intergenic
1174718442 20:52785163-52785185 CAAGTGCTTAAAACAGTGTCTGG + Intergenic
1174819030 20:53711557-53711579 CCAGTGACTAAAACAGTGCCTGG + Intergenic
1179344682 21:40545847-40545869 TCACTGAGAAAACCAGTGACTGG + Intronic
1181080015 22:20407602-20407624 CTCCTGATTAAAGCCGTGTCAGG - Exonic
949789467 3:7777285-7777307 CCAGTGCCTAAAACAGTGTCTGG - Intergenic
949927425 3:9052754-9052776 CCACTGAATAAAACTGTCTCTGG + Intronic
950536737 3:13583245-13583267 CCAGTGATTAACACAGTGCCTGG - Intronic
952204405 3:31165604-31165626 CCACTGAGTAAACCAGTCCCTGG + Intergenic
952766471 3:36958368-36958390 TCAGTAATTAAACCAATGTCAGG + Intergenic
953538469 3:43793782-43793804 ACACTGATTAAACCAGGGGAGGG - Intergenic
957191826 3:77019634-77019656 CCACTGGTGAAACCAGTGTCAGG + Intronic
963759764 3:149275552-149275574 CCAATGATTAAAGCAGAGACTGG - Intergenic
971462313 4:26913799-26913821 CCAGTGCCTAAACCAGTATCTGG - Intronic
972731820 4:41802227-41802249 CCAGTGTTCAAAACAGTGTCTGG + Intergenic
972807217 4:42541663-42541685 GCACTGAATAATCCATTGTCTGG - Intronic
974374932 4:61063770-61063792 CCACTGCTAAGCCCAGTGTCTGG - Intergenic
977274126 4:94954207-94954229 CCAAGGAATAAACCAGTCTCTGG - Intronic
978657927 4:111088625-111088647 CCTCTGAGGAAACCAGTGTCAGG + Intergenic
978854929 4:113383886-113383908 CCAGTGCTTAATCCAGTGCCAGG - Intergenic
981487504 4:145302542-145302564 CCATTGACTAAAGAAGTGTCTGG - Intergenic
991722026 5:69502506-69502528 TCACTGATTAAATCAATGCCTGG - Intronic
992767190 5:80012242-80012264 CCACTGATTGAACCAGGGATTGG + Intronic
995137533 5:108696117-108696139 CCATTTATTAACCCTGTGTCTGG - Intergenic
998313048 5:141154234-141154256 CAACTGATTAAATGAGTGTGGGG + Intergenic
999544321 5:152610131-152610153 CCAGTGACTGAAACAGTGTCTGG - Intergenic
999922829 5:156341279-156341301 CCTCTGCTTAAAGCAGGGTCTGG - Intronic
1000491445 5:161919437-161919459 CCAGTGCTTAAGACAGTGTCTGG - Intergenic
1001413693 5:171528465-171528487 CCACTTTTTAGAACAGTGTCAGG + Intergenic
1001563510 5:172685213-172685235 CCACTGATTAAACCAGTGTCAGG - Intronic
1002985326 6:2184963-2184985 CCAGTGCCTAAAACAGTGTCTGG - Intronic
1007667823 6:43526203-43526225 CCAGTAACTAAATCAGTGTCTGG - Intronic
1009741723 6:67755847-67755869 CCACTGAATGAACCAACGTCAGG + Intergenic
1010700547 6:79039576-79039598 CAACTGCTTAAAACAGTGGCTGG + Intronic
1010703965 6:79085888-79085910 CCAGGGCTTAATCCAGTGTCTGG - Intergenic
1010937641 6:81880829-81880851 AAAGTGATTAAAACAGTGTCTGG + Intergenic
1011355330 6:86467457-86467479 CCACTGACTAAAAGAGTGCCTGG - Intergenic
1012454938 6:99393454-99393476 CCAGTGCTCATACCAGTGTCTGG + Intronic
1013395402 6:109732400-109732422 CCACTGATTATGCCAGTGAGAGG - Intronic
1015426101 6:133069443-133069465 CAACTTATTAAACAAGTGTTTGG - Intergenic
1017151400 6:151283740-151283762 CCACTGTTAAAAGCAATGTCAGG + Intronic
1019524502 7:1474656-1474678 CCCCTGGTTAAACCAGTGTCTGG + Intronic
1021357523 7:19670444-19670466 ACACTGCTTAAATCAATGTCAGG + Intergenic
1021359214 7:19690869-19690891 CAAGTGATTAAACAAATGTCAGG - Intergenic
1022427443 7:30282974-30282996 CCAGTGTTTAACACAGTGTCTGG - Intergenic
1026158381 7:67847440-67847462 CCACTGATTTATTCAGTGCCTGG - Intergenic
1026573837 7:71555343-71555365 CGACCAATCAAACCAGTGTCTGG + Intronic
1026573887 7:71555680-71555702 CCCATCATCAAACCAGTGTCTGG + Intronic
1029666709 7:101999854-101999876 CCACTGATAAAACCAGGCCCTGG - Intronic
1031084678 7:117290825-117290847 CCAGTGATTATAAGAGTGTCTGG + Intronic
1033481111 7:141741487-141741509 GCAATGATCAAACAAGTGTCAGG - Intronic
1033970687 7:147035056-147035078 CTACTGATTAAAGCAGGATCTGG - Intronic
1037715616 8:21394907-21394929 CCACTGCTTGGACCAGTGTCTGG + Intergenic
1039218399 8:35299306-35299328 CCCCTGATAAAAGCAGTGCCAGG + Intronic
1046217595 8:111169928-111169950 CCACTGATCAAAGCAGTGACAGG - Intergenic
1050722871 9:8611244-8611266 CCTCTGATTAGAACAGAGTCAGG - Intronic
1052291901 9:26851674-26851696 CCACTGATTAAACAGGGTTCTGG + Intronic
1055871358 9:80884571-80884593 CCTCTGAGTAAAGCAGTGTTAGG - Intergenic
1058775078 9:108274856-108274878 CCAGTGACTAGAACAGTGTCCGG + Intergenic
1059662293 9:116414027-116414049 CCACTGACCAAACCAGTGCCAGG + Intergenic
1186787262 X:12965187-12965209 TCATTTATTAAACCAGTGCCAGG - Intergenic
1187473894 X:19592655-19592677 CCACTGATTGAAGCAGTCACAGG - Intronic
1187737228 X:22317167-22317189 CCACTGATTTAACCACTGTTGGG + Intergenic
1190474076 X:50810814-50810836 CCACTGAATACATCAGTCTCGGG + Intronic
1194501424 X:94686179-94686201 CCTCTGATTAAAGAAGAGTCAGG - Intergenic
1196228360 X:113191922-113191944 CCACTGCTAAATCCAATGTCAGG - Intergenic
1197410705 X:126112392-126112414 CCACTGATCAAAACAGGATCTGG - Intergenic
1197653909 X:129095220-129095242 CCACTGAATAAGCCAGCGTTAGG - Intergenic