ID: 1001565983

View in Genome Browser
Species Human (GRCh38)
Location 5:172699795-172699817
Sequence AGAGCACAGCGAAGGCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001565974_1001565983 20 Left 1001565974 5:172699752-172699774 CCTCCAGGTGGAGAAGAGGAAGG No data
Right 1001565983 5:172699795-172699817 AGAGCACAGCGAAGGCCCAGGGG No data
1001565976_1001565983 17 Left 1001565976 5:172699755-172699777 CCAGGTGGAGAAGAGGAAGGAAG No data
Right 1001565983 5:172699795-172699817 AGAGCACAGCGAAGGCCCAGGGG No data
1001565979_1001565983 -10 Left 1001565979 5:172699782-172699804 CCAGGCAGATGGAAGAGCACAGC No data
Right 1001565983 5:172699795-172699817 AGAGCACAGCGAAGGCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001565983 Original CRISPR AGAGCACAGCGAAGGCCCAG GGG Intergenic
No off target data available for this crispr