ID: 1001566485

View in Genome Browser
Species Human (GRCh38)
Location 5:172702759-172702781
Sequence ACTTTTATGCAGGTCAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001566485_1001566489 28 Left 1001566485 5:172702759-172702781 CCTTGCCTGACCTGCATAAAAGT No data
Right 1001566489 5:172702810-172702832 GACCCTTTGTAGCCACACTATGG No data
1001566485_1001566488 6 Left 1001566485 5:172702759-172702781 CCTTGCCTGACCTGCATAAAAGT No data
Right 1001566488 5:172702788-172702810 TGAAATGTGACTTGCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001566485 Original CRISPR ACTTTTATGCAGGTCAGGCA AGG (reversed) Intergenic
No off target data available for this crispr