ID: 1001568074

View in Genome Browser
Species Human (GRCh38)
Location 5:172713323-172713345
Sequence CTGTGGACAAATAAAGACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001568071_1001568074 -8 Left 1001568071 5:172713308-172713330 CCTCCCTGAAAAACACTGTGGAC No data
Right 1001568074 5:172713323-172713345 CTGTGGACAAATAAAGACTAAGG No data
1001568068_1001568074 12 Left 1001568068 5:172713288-172713310 CCAGTGGGTGGGCGCCGTGGCCT No data
Right 1001568074 5:172713323-172713345 CTGTGGACAAATAAAGACTAAGG No data
1001568069_1001568074 -2 Left 1001568069 5:172713302-172713324 CCGTGGCCTCCCTGAAAAACACT No data
Right 1001568074 5:172713323-172713345 CTGTGGACAAATAAAGACTAAGG No data
1001568067_1001568074 13 Left 1001568067 5:172713287-172713309 CCCAGTGGGTGGGCGCCGTGGCC No data
Right 1001568074 5:172713323-172713345 CTGTGGACAAATAAAGACTAAGG No data
1001568065_1001568074 20 Left 1001568065 5:172713280-172713302 CCGGGTGCCCAGTGGGTGGGCGC No data
Right 1001568074 5:172713323-172713345 CTGTGGACAAATAAAGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001568074 Original CRISPR CTGTGGACAAATAAAGACTA AGG Intergenic
No off target data available for this crispr