ID: 1001576911

View in Genome Browser
Species Human (GRCh38)
Location 5:172770701-172770723
Sequence CACCACGGCGTGGTAGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001576905_1001576911 9 Left 1001576905 5:172770669-172770691 CCGTCCAGGGCGGCGCTGCGCTC 0: 1
1: 0
2: 0
3: 14
4: 132
Right 1001576911 5:172770701-172770723 CACCACGGCGTGGTAGGCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1001576906_1001576911 5 Left 1001576906 5:172770673-172770695 CCAGGGCGGCGCTGCGCTCGTCC 0: 1
1: 0
2: 0
3: 11
4: 82
Right 1001576911 5:172770701-172770723 CACCACGGCGTGGTAGGCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1001576901_1001576911 24 Left 1001576901 5:172770654-172770676 CCGTCGCGCTTGGCGCCGTCCAG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1001576911 5:172770701-172770723 CACCACGGCGTGGTAGGCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001576911 Original CRISPR CACCACGGCGTGGTAGGCGC CGG Exonic
903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG + Intergenic
904280917 1:29417603-29417625 CACCCCTGTGTGGTAGGAGCTGG + Intergenic
912409140 1:109467443-109467465 CACCAAGGAGTGGTATGTGCAGG - Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
922894190 1:229088073-229088095 GACCCCGGCGTGGGAGGGGCTGG - Intergenic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1066654917 10:37688155-37688177 CACCATGGGGTGGAAGGGGCTGG - Intergenic
1067039873 10:42943625-42943647 CACCACGGGGTGGAAGGGGCTGG - Intergenic
1068348350 10:55813276-55813298 CTCCATGGCGTGGGAGGCCCAGG - Intergenic
1070032724 10:72692551-72692573 CACCAGGGCGGGGAAGGCACGGG + Intronic
1072710738 10:97714277-97714299 CAGGAAGGCGTGGTAGGCGCAGG - Exonic
1074148869 10:110740603-110740625 CACCAGGGCTTGGTAGGGGTGGG + Intronic
1077090564 11:776669-776691 CACCACGGAGAGGTGGGGGCCGG - Intronic
1078141949 11:8699360-8699382 CACCACCGCGTGGGAGCAGCTGG + Exonic
1084312445 11:68324896-68324918 CGCCACTGGGTGCTAGGCGCTGG + Intronic
1084470307 11:69355595-69355617 CACCACGGTTTGGTTGGCTCTGG - Intronic
1088268403 11:108009218-108009240 CACCAGGGTGTGGTGGGCGCTGG - Exonic
1090279874 11:125446409-125446431 CAACCCTGCGGGGTAGGCGCAGG - Intronic
1090608623 11:128450803-128450825 CACCACCCCCTGGTAGGCCCCGG - Intergenic
1092094149 12:5827888-5827910 CACCACTGCCTGGCAGGGGCGGG + Intronic
1092230689 12:6773921-6773943 CACCGCGGCGCGGTACTCGCCGG - Exonic
1108727882 13:53201537-53201559 CACCGTGGCCAGGTAGGCGCTGG - Intergenic
1110983491 13:81934097-81934119 TACCAGGGCGTGGTAGGGGTTGG + Intergenic
1111220943 13:85205183-85205205 CACCACGGGGCGGGGGGCGCTGG - Intergenic
1114612552 14:24052245-24052267 CACCACGGGGAGGAACGCGCTGG - Intronic
1123943596 15:25228379-25228401 TACCTAGGCGTGGTGGGCGCTGG - Intergenic
1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG + Intronic
1128672829 15:69587045-69587067 CACCTGCGCGTGGTAGGTGCTGG + Intergenic
1136659337 16:31742316-31742338 CACCAGGGCCTGGTGGGGGCTGG - Intronic
1137512903 16:49117005-49117027 CACCACGGTGTTGTGGGGGCTGG - Intergenic
1141608566 16:85169190-85169212 CCCCACGCCTTGGCAGGCGCCGG + Intergenic
1154230636 18:12553135-12553157 CACCACAGCGGGGAAGGGGCTGG - Intronic
1157354137 18:46917625-46917647 CAGCACGCCGGGGCAGGCGCGGG - Intronic
1162371638 19:10283574-10283596 CACCACGGTGAGGTTGGCCCGGG - Exonic
1167797583 19:51719776-51719798 CACCCCGGCGGCGTAGGCCCAGG + Exonic
935046907 2:99490427-99490449 CCCCAAGGCGGGGCAGGCGCGGG - Intergenic
935866468 2:107392559-107392581 GCCCACGGCGGGGTAGCCGCGGG - Intergenic
937274587 2:120675574-120675596 CACCCCTGCGTGGCAGGCACCGG + Intergenic
962318812 3:134374693-134374715 CACCGCGGCCTGGAGGGCGCTGG - Intronic
966635501 3:182128804-182128826 CACCAAGGCGTGGCAGCCCCTGG + Intergenic
966911668 3:184563151-184563173 CAGCCCGGCGTTGTTGGCGCTGG + Intronic
981599729 4:146472711-146472733 CACCACTGCTTGGCAGGAGCTGG - Intronic
982197403 4:152930155-152930177 CACCACTGTGTGGAAGGCACAGG - Intergenic
999397750 5:151240965-151240987 CACCACTGGGTGGTAGGAGTGGG - Intronic
1001576911 5:172770701-172770723 CACCACGGCGTGGTAGGCGCCGG + Exonic
1014185842 6:118433152-118433174 CACCAGGGCCTGTTAGGGGCTGG + Intergenic
1019577928 7:1746475-1746497 CACCACAGCGTGGAGGCCGCCGG + Exonic
1021606711 7:22415558-22415580 CATCACGACGTGGTAGGAGATGG - Intergenic
1026360413 7:69597984-69598006 CGCCAGGGCGTGGAAGCCGCCGG - Intergenic
1027250045 7:76393341-76393363 CACTGCGGCGTGGGAGGGGCGGG - Intronic
1030102104 7:105955898-105955920 CACGGCGGCGGGGTAGGCTCAGG + Intronic
1034498489 7:151435690-151435712 CAGCTCTGCGGGGTAGGCGCGGG + Intronic
1037981154 8:23255287-23255309 CACCACGGGGTGGGAGGAGAGGG - Exonic
1038441619 8:27574596-27574618 CACCAGGGTGGGGTAGGGGCGGG + Intergenic
1050398137 9:5222220-5222242 CACCATGGGGTGGTAGGGGTGGG - Intergenic
1059061423 9:111038314-111038336 GACCCCGGCGGGGTGGGCGCAGG - Intronic
1062637076 9:137497176-137497198 CTCGTCGGCGTGGTAGGTGCTGG - Exonic
1190598240 X:52067023-52067045 CACCAAGTCGGGGAAGGCGCTGG - Exonic
1190610584 X:52187050-52187072 CACCAAGTCGGGGAAGGCGCTGG + Exonic
1201489447 Y:14524780-14524802 CACCGCGGAGTGGAAGGCGCAGG - Intronic