ID: 1001577535

View in Genome Browser
Species Human (GRCh38)
Location 5:172773914-172773936
Sequence CTGTAACCACAGAAGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001577532_1001577535 -5 Left 1001577532 5:172773896-172773918 CCCAGCATAATCTGGTCTCTGTA No data
Right 1001577535 5:172773914-172773936 CTGTAACCACAGAAGGAGTGAGG No data
1001577533_1001577535 -6 Left 1001577533 5:172773897-172773919 CCAGCATAATCTGGTCTCTGTAA No data
Right 1001577535 5:172773914-172773936 CTGTAACCACAGAAGGAGTGAGG No data
1001577530_1001577535 5 Left 1001577530 5:172773886-172773908 CCAAAGAGAGCCCAGCATAATCT No data
Right 1001577535 5:172773914-172773936 CTGTAACCACAGAAGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001577535 Original CRISPR CTGTAACCACAGAAGGAGTG AGG Intergenic
No off target data available for this crispr