ID: 1001577544

View in Genome Browser
Species Human (GRCh38)
Location 5:172773945-172773967
Sequence TTGTGGGCCTGGCTGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001577537_1001577544 2 Left 1001577537 5:172773920-172773942 CCACAGAAGGAGTGAGGGACTGG No data
Right 1001577544 5:172773945-172773967 TTGTGGGCCTGGCTGCCAGAGGG No data
1001577533_1001577544 25 Left 1001577533 5:172773897-172773919 CCAGCATAATCTGGTCTCTGTAA No data
Right 1001577544 5:172773945-172773967 TTGTGGGCCTGGCTGCCAGAGGG No data
1001577532_1001577544 26 Left 1001577532 5:172773896-172773918 CCCAGCATAATCTGGTCTCTGTA No data
Right 1001577544 5:172773945-172773967 TTGTGGGCCTGGCTGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001577544 Original CRISPR TTGTGGGCCTGGCTGCCAGA GGG Intergenic
No off target data available for this crispr