ID: 1001580058

View in Genome Browser
Species Human (GRCh38)
Location 5:172792094-172792116
Sequence AAGGCCCCACAGTTGGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001580058_1001580066 17 Left 1001580058 5:172792094-172792116 CCAGGGACCAACTGTGGGGCCTT No data
Right 1001580066 5:172792134-172792156 TCTCTGTGCTTCAGTTTGCTGGG No data
1001580058_1001580067 23 Left 1001580058 5:172792094-172792116 CCAGGGACCAACTGTGGGGCCTT No data
Right 1001580067 5:172792140-172792162 TGCTTCAGTTTGCTGGGTCCTGG No data
1001580058_1001580065 16 Left 1001580058 5:172792094-172792116 CCAGGGACCAACTGTGGGGCCTT No data
Right 1001580065 5:172792133-172792155 CTCTCTGTGCTTCAGTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001580058 Original CRISPR AAGGCCCCACAGTTGGTCCC TGG (reversed) Intergenic
No off target data available for this crispr