ID: 1001585061

View in Genome Browser
Species Human (GRCh38)
Location 5:172828196-172828218
Sequence CTCTGGCCTCGTCTTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001585061_1001585068 3 Left 1001585061 5:172828196-172828218 CCTGCCTCAAGACGAGGCCAGAG No data
Right 1001585068 5:172828222-172828244 AACAAAGAAGAACCTGGGGATGG No data
1001585061_1001585065 -3 Left 1001585061 5:172828196-172828218 CCTGCCTCAAGACGAGGCCAGAG No data
Right 1001585065 5:172828216-172828238 GAGGAAAACAAAGAAGAACCTGG No data
1001585061_1001585067 -1 Left 1001585061 5:172828196-172828218 CCTGCCTCAAGACGAGGCCAGAG No data
Right 1001585067 5:172828218-172828240 GGAAAACAAAGAAGAACCTGGGG No data
1001585061_1001585066 -2 Left 1001585061 5:172828196-172828218 CCTGCCTCAAGACGAGGCCAGAG No data
Right 1001585066 5:172828217-172828239 AGGAAAACAAAGAAGAACCTGGG No data
1001585061_1001585069 4 Left 1001585061 5:172828196-172828218 CCTGCCTCAAGACGAGGCCAGAG No data
Right 1001585069 5:172828223-172828245 ACAAAGAAGAACCTGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001585061 Original CRISPR CTCTGGCCTCGTCTTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr