ID: 1001586159

View in Genome Browser
Species Human (GRCh38)
Location 5:172834813-172834835
Sequence CTCAGCTGACAGGTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001586140_1001586159 24 Left 1001586140 5:172834766-172834788 CCAGCATCCCTCTCCTCCCTCTA 0: 1
1: 0
2: 6
3: 90
4: 909
Right 1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG No data
1001586148_1001586159 -4 Left 1001586148 5:172834794-172834816 CCTCCTTGGTGGACCCCACCTCA 0: 1
1: 0
2: 2
3: 26
4: 732
Right 1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG No data
1001586138_1001586159 26 Left 1001586138 5:172834764-172834786 CCCCAGCATCCCTCTCCTCCCTC 0: 1
1: 0
2: 13
3: 179
4: 1398
Right 1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG No data
1001586149_1001586159 -7 Left 1001586149 5:172834797-172834819 CCTTGGTGGACCCCACCTCAGCT 0: 1
1: 0
2: 2
3: 35
4: 190
Right 1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG No data
1001586139_1001586159 25 Left 1001586139 5:172834765-172834787 CCCAGCATCCCTCTCCTCCCTCT 0: 1
1: 1
2: 6
3: 161
4: 987
Right 1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG No data
1001586146_1001586159 7 Left 1001586146 5:172834783-172834805 CCTCTACTGAGCCTCCTTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG No data
1001586141_1001586159 17 Left 1001586141 5:172834773-172834795 CCCTCTCCTCCCTCTACTGAGCC 0: 1
1: 0
2: 2
3: 63
4: 564
Right 1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG No data
1001586142_1001586159 16 Left 1001586142 5:172834774-172834796 CCTCTCCTCCCTCTACTGAGCCT 0: 1
1: 0
2: 5
3: 65
4: 538
Right 1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG No data
1001586143_1001586159 11 Left 1001586143 5:172834779-172834801 CCTCCCTCTACTGAGCCTCCTTG 0: 1
1: 0
2: 2
3: 28
4: 292
Right 1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG No data
1001586145_1001586159 8 Left 1001586145 5:172834782-172834804 CCCTCTACTGAGCCTCCTTGGTG 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001586159 Original CRISPR CTCAGCTGACAGGTGGGGCA GGG Intronic
No off target data available for this crispr