ID: 1001586560

View in Genome Browser
Species Human (GRCh38)
Location 5:172836751-172836773
Sequence GCTTATGGGGTCCCAGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001586554_1001586560 -5 Left 1001586554 5:172836733-172836755 CCAAGAGAAGGGAGGAGGGCTTA 0: 1
1: 0
2: 1
3: 16
4: 247
Right 1001586560 5:172836751-172836773 GCTTATGGGGTCCCAGGAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 129
1001586548_1001586560 12 Left 1001586548 5:172836716-172836738 CCGGCTCTCTTTGCATTCCAAGA 0: 1
1: 0
2: 1
3: 16
4: 236
Right 1001586560 5:172836751-172836773 GCTTATGGGGTCCCAGGAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001586560 Original CRISPR GCTTATGGGGTCCCAGGAGT GGG Intronic
900179651 1:1305608-1305630 GCTGAGGGGCTCCCAGCAGTGGG - Intronic
900394213 1:2446484-2446506 GCTGCAGGGGTCCCAGGAGGCGG + Intronic
900691548 1:3983488-3983510 GCTTCTGAGGTCCCAGCAGGAGG + Intergenic
903247379 1:22025825-22025847 GCTTCTAGGGTCCCAGGACGAGG - Intergenic
907457835 1:54586833-54586855 GCTTCTGGGATCCAAGGAGCAGG + Intronic
907471632 1:54677809-54677831 GGATATGGGGACACAGGAGTGGG + Intronic
908769362 1:67582436-67582458 GGTTATGAGGTGCCTGGAGTGGG - Intergenic
912023477 1:105137920-105137942 GCCCATGGGGCCCCAGGAGTAGG - Intergenic
922202371 1:223416855-223416877 ACTGCTGGGATCCCAGGAGTGGG - Intergenic
922784353 1:228275741-228275763 GCCTCTGGGGTCGCAGGAGAGGG - Exonic
1063366236 10:5492728-5492750 GCTGATGGTGGCCCAGGAGGAGG + Intergenic
1070280913 10:75047568-75047590 ATTTATGTGGACCCAGGAGTGGG - Intronic
1070393330 10:75989939-75989961 GCCTGTGGGGTCTCAGGAGCGGG - Intronic
1071563350 10:86659327-86659349 GCTCATGTAGTCCCAGGAGCAGG - Exonic
1073163360 10:101420714-101420736 GCTTTTGGAGTCCAAGTAGTAGG - Intronic
1076549296 10:131267632-131267654 GCTTATGGGCTCCCAGGACATGG + Intronic
1077110527 11:860209-860231 ACTTGTGGGGCCCCAGCAGTGGG + Intronic
1077305376 11:1866588-1866610 GCTTATGGGGGGCCAGGGGTAGG - Exonic
1079405949 11:20145876-20145898 TCTTATAAGATCCCAGGAGTTGG - Intergenic
1083378303 11:62243987-62244009 GAGTATGGGGTCTCAGGAGCTGG - Intronic
1084311193 11:68317274-68317296 GCTGGTGGGGTCCCAAGAGCTGG + Intronic
1084644296 11:70445729-70445751 GATGATGGGGTCCTAGGAGCTGG + Intergenic
1087632654 11:100669085-100669107 GCTTTGGGGATTCCAGGAGTTGG + Intergenic
1096979310 12:55719250-55719272 GCCAATGGGGGCCCAGGATTGGG - Intronic
1099859793 12:88211815-88211837 GGTTTTGGGGTTTCAGGAGTTGG - Intergenic
1100403466 12:94252167-94252189 GATTTTGGGCTCCCAGGACTTGG + Intronic
1103396039 12:120607937-120607959 GGTTTTGGGGTCTCTGGAGTTGG + Intergenic
1105009619 12:132746933-132746955 ACTTTTGGGCTCCCAGGGGTGGG + Intronic
1109367609 13:61377063-61377085 TCATATGGGATCCCAGAAGTAGG - Intergenic
1112090538 13:96078570-96078592 GGTTTTGGGGGCTCAGGAGTCGG + Intergenic
1114691058 14:24582062-24582084 GCTTATGGGGCCCAGGGAGGAGG - Intergenic
1119609841 14:76052435-76052457 GTTCATGGGGTCCCTGCAGTTGG + Intronic
1121269223 14:92626773-92626795 GTTTAGAGGGTTCCAGGAGTTGG + Intronic
1124645679 15:31436287-31436309 GTTTCTGGGGTCCCAGTAGGAGG + Intergenic
1130272637 15:82460034-82460056 GGTCATGGGGGCCCAGGAGGGGG - Intergenic
1130464989 15:84187387-84187409 GGTCATGGGGGCCCAGGAGGGGG - Intergenic
1130487699 15:84407417-84407439 GGTCATGGGGGCCCAGGAGGGGG + Intergenic
1130499276 15:84486150-84486172 GGTCATGGGGGCCCAGGAGGGGG + Intergenic
1130587279 15:85192001-85192023 GGTCATGGGGGCCCAGGAGGGGG - Intergenic
1131352367 15:91712940-91712962 GCTAAAAGGGTCTCAGGAGTTGG - Intergenic
1132749016 16:1448827-1448849 GCCTCTGGGCTCCCAGGGGTAGG - Intronic
1133295064 16:4747634-4747656 GGTAGTGGGATCCCAGGAGTGGG + Exonic
1136103819 16:28014588-28014610 GATTGTTGGATCCCAGGAGTTGG - Intronic
1138628826 16:58277013-58277035 CCTGATGGGGTGACAGGAGTGGG + Intronic
1142261340 16:89043873-89043895 GCTTGTGAGGTCTCAGAAGTCGG - Intergenic
1143631418 17:8142504-8142526 CCTTGTGAGGTCCCAGGAGTGGG - Intronic
1145248369 17:21284409-21284431 GCTCAGTGGGTCCCGGGAGTGGG + Intergenic
1149254990 17:54816067-54816089 GGTTTTGGGGTCTCTGGAGTTGG + Intergenic
1149304238 17:55333062-55333084 CCCTATGCGGTCTCAGGAGTTGG - Intergenic
1149513353 17:57260441-57260463 GTTTATGGGGTAACAGGTGTGGG - Intronic
1149778518 17:59377757-59377779 GCTTATGGGGTCTAAGCCGTAGG + Intronic
1152239049 17:79152146-79152168 GCGAGTGGGGTCCCAGGAGAGGG + Intronic
1155066687 18:22274314-22274336 GCTTATAGGCTCCCTGAAGTTGG + Intergenic
1156062232 18:33093225-33093247 GATTAAAGGGTCCCAGGACTGGG - Intronic
1163098453 19:15078410-15078432 GTTTATTTGGTCCCAGAAGTGGG - Intergenic
1163369358 19:16893425-16893447 GCTTGTAGGGTGCCAGGGGTGGG + Intronic
1163418799 19:17202765-17202787 AGTTATGGGGTGCCAGGGGTGGG + Intronic
1163755915 19:19106096-19106118 GCTGATGGGGTCTCTGGAGTGGG - Intronic
1167521721 19:49959469-49959491 GGTTCTGGGGCCCCAGGGGTGGG + Exonic
1167523662 19:49971253-49971275 GGTTCTGGGGCCCCAGGGGTGGG - Intergenic
925346241 2:3173901-3173923 GAATATGGGGTCCCTGGACTCGG + Intergenic
926826029 2:16905786-16905808 GGTTTTGGGGTCTCTGGAGTTGG - Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
932370045 2:71179250-71179272 CCTTATGGAGTCTCAGGAGAGGG - Intergenic
936607905 2:113976232-113976254 TCTGATGGGGTCCTAGCAGTGGG - Intergenic
937320644 2:120958759-120958781 TCTTGTGGGGTCTCAGGAGAAGG - Intronic
939690291 2:145251313-145251335 GTTTTTGGGGTCCCAGGATTGGG - Intergenic
942927000 2:181446077-181446099 GCTTATGTGGCCCAAGGAGTAGG - Intergenic
1171233959 20:23509561-23509583 GCTGCTGGCCTCCCAGGAGTGGG + Intergenic
1172143827 20:32742983-32743005 GCTTTTGGGGTCCTAGAAGAGGG - Intronic
1172869411 20:38126516-38126538 GCTAGTGGGCTCCCCGGAGTGGG + Intronic
1173381452 20:42546759-42546781 GAATATGGGGGCCCAGGAGAGGG + Intronic
1175607239 20:60321115-60321137 GCTCCTGGGGTCGCAGGGGTCGG - Intergenic
1175960100 20:62631540-62631562 GGGTGGGGGGTCCCAGGAGTGGG + Intergenic
1177529189 21:22338073-22338095 GCTTATGGGCTAGCAAGAGTGGG + Intergenic
1179429311 21:41308842-41308864 GGTCATCAGGTCCCAGGAGTAGG + Intronic
1179629406 21:42667227-42667249 GCTTATGGGCTGCTAGAAGTTGG - Intronic
1179821527 21:43939989-43940011 GCTCCTGGGGTCCCTTGAGTTGG + Intronic
1180202034 21:46229696-46229718 GCTCACGGGGTCGCTGGAGTTGG + Intergenic
1181236381 22:21449990-21450012 GGTTAGGGGGCCCCAGGAGTGGG - Exonic
1184645702 22:45893462-45893484 GCTGGTGGTGTCTCAGGAGTAGG - Intergenic
1185060890 22:48606184-48606206 GATTTTGGGGTCCCAGGGTTTGG - Intronic
949352203 3:3135466-3135488 GGTGATGTGGTCCCAGAAGTGGG + Intronic
949590349 3:5487634-5487656 GCTTATGGGGTGGCAGTAGGGGG + Intergenic
951345999 3:21547478-21547500 GCCTAAGGGGTCCCAGCAGAAGG - Intronic
951751725 3:26043374-26043396 GCTTATGGGGGACTAGGATTAGG - Intergenic
953186118 3:40639873-40639895 GGGTTTGGGATCCCAGGAGTAGG - Intergenic
955402696 3:58604558-58604580 TCTTATGGGGCCCAGGGAGTGGG - Intronic
955470737 3:59283579-59283601 CCCTATGGGGGCCCTGGAGTTGG + Intergenic
956636299 3:71368826-71368848 TGTTATGGGGTCTCAGCAGTTGG - Intronic
957171615 3:76744444-76744466 GATCATGGGGGCCCAGGAGGTGG - Intronic
966465753 3:180229245-180229267 CCTTATGGAGCCCCAGGAATTGG + Intergenic
969283822 4:6190092-6190114 CCTTCTTGGGCCCCAGGAGTGGG - Intronic
971040249 4:22743857-22743879 GTTTATGGGGGCCCAGGGGTGGG + Intergenic
972164166 4:36261891-36261913 GCTTGTGGGGGACCAGGAGGAGG + Intergenic
980529226 4:134029374-134029396 GCTTAGGGGTTTCCAGTAGTTGG - Intergenic
985746781 5:1652496-1652518 ACTCATGTGGTCCCTGGAGTGGG - Intergenic
991131759 5:63130827-63130849 GCTAATGGTGTCCCAGGAATAGG + Intergenic
992944894 5:81800341-81800363 GCAGATGGGATCCCAGTAGTAGG + Intergenic
993465995 5:88248146-88248168 TCTTTTGGGGACCCAGGATTTGG - Intronic
993531380 5:89028932-89028954 GCTTATGTGCACCCAGAAGTAGG + Intergenic
994407729 5:99366382-99366404 GCTTTTGGAGTCTCAGGGGTAGG - Intergenic
996230282 5:121054987-121055009 GGTTTTGGGGTTTCAGGAGTTGG - Intergenic
997436797 5:133881509-133881531 GCTGATGGGGGCACAGAAGTGGG + Intergenic
998929085 5:147160591-147160613 CCTTTGGGGATCCCAGGAGTTGG + Intergenic
1001586560 5:172836751-172836773 GCTTATGGGGTCCCAGGAGTGGG + Intronic
1003351211 6:5319261-5319283 CCTGATGGGATCTCAGGAGTTGG + Intronic
1005559730 6:27026272-27026294 GATCATGGGAGCCCAGGAGTTGG - Intergenic
1006552285 6:34834510-34834532 GCCTCTGGGTTCCCAGGAATGGG - Intronic
1007749224 6:44062007-44062029 GCTTCTGGGGTCTGAGGACTGGG + Intergenic
1011603681 6:89081641-89081663 TCTGATTGGCTCCCAGGAGTCGG + Intronic
1013295831 6:108757625-108757647 GCTTCTATGGTCCCAGAAGTTGG - Intergenic
1013849650 6:114498409-114498431 GCTGAAGGGCTCCTAGGAGTGGG - Intergenic
1014468309 6:121783667-121783689 GCTTACTGGGCTCCAGGAGTGGG - Intergenic
1016458764 6:144260284-144260306 TCTTTTGGGTTGCCAGGAGTAGG - Intergenic
1018599456 6:165524314-165524336 GGTTTTGGGGTTCCTGGAGTTGG + Intronic
1019604433 7:1901472-1901494 GCCTATGTGGTCCCAGGGCTGGG - Intronic
1020563663 7:9768503-9768525 GATGATGGGGTCTCAGGAGTGGG + Intergenic
1029364293 7:100107292-100107314 GCTTTTGGAGTCCCTGGAGCTGG + Exonic
1030025693 7:105322551-105322573 GCATATTGGCTCCCAGGAGTTGG + Intronic
1031676183 7:124615143-124615165 GCTTTTGGGGTTTCTGGAGTTGG + Intergenic
1031784959 7:126018141-126018163 GCTTCTGGGGTCCCAGGGGTAGG - Intergenic
1034499026 7:151438338-151438360 GCTTTTGGGGGCCTGGGAGTAGG - Intronic
1037608516 8:20457392-20457414 GCTTTTGGGCAGCCAGGAGTTGG - Intergenic
1039608306 8:38900834-38900856 GCCTTTGGGGACCGAGGAGTTGG - Intergenic
1045642716 8:104269675-104269697 GCCTTAGGGGTCCCAGGAGAGGG + Intergenic
1047334209 8:123920469-123920491 GGTTCTGTGGTCCCAAGAGTTGG + Intronic
1047486965 8:125339966-125339988 GCTTATGGTTTCCCAGGATCAGG - Intronic
1049748253 8:144272079-144272101 GCTTATGAGATGCCAGGCGTTGG - Intronic
1052829538 9:33203527-33203549 TTTGATGGGGCCCCAGGAGTGGG - Intergenic
1055466368 9:76570534-76570556 GCTTATAGGGTCCCATGGGTTGG - Intergenic
1057585060 9:96321624-96321646 GCATTTGGGGTCTCAGCAGTGGG - Intronic
1059531862 9:115042848-115042870 TCTTTCTGGGTCCCAGGAGTAGG + Intronic
1060627534 9:125127271-125127293 GCTTTTGAGGTACCAGGAGAAGG - Intronic
1061655328 9:132085251-132085273 GCTTATTGAGTCCCAGGCATTGG - Intergenic
1062113494 9:134795567-134795589 GTCTTTGGGGTCCCAGGTGTTGG - Intronic
1062242583 9:135548217-135548239 GCTTGTGGGGTCTCAGGTGTAGG + Intronic
1062279671 9:135746381-135746403 GTTTCTGGGGTGCCAGGAGGAGG + Intronic
1062390807 9:136333164-136333186 GCTTGGGGGGCCCCAGGAGGTGG - Intronic
1186990468 X:15061652-15061674 GCTTATGAGTGCTCAGGAGTTGG + Intergenic
1195559762 X:106269917-106269939 GCTTCCGTGGTCCCAGGATTAGG + Intergenic
1195562199 X:106296422-106296444 GCTTCCGTGGTCCCAGGATTAGG - Intergenic
1200215976 X:154368471-154368493 GCCTATGGGGAACCAGGAGGAGG + Intronic
1202370247 Y:24191302-24191324 GGTCATGGGGGCCCAGGAGGGGG + Intergenic
1202500537 Y:25478815-25478837 GGTCATGGGGGCCCAGGAGGGGG - Intergenic