ID: 1001587371

View in Genome Browser
Species Human (GRCh38)
Location 5:172842533-172842555
Sequence AGGATCCAGCGGTCCCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001587371 Original CRISPR AGGATCCAGCGGTCCCACTT TGG (reversed) Intronic
900756045 1:4435502-4435524 ACGATCCAGCAATCCCACTTCGG - Intergenic
904833137 1:33318443-33318465 AGAAAGCAGGGGTCCCACTTGGG - Intronic
905521772 1:38605803-38605825 AGGCTCCAGCGGCCTCCCTTGGG - Intergenic
909707470 1:78604653-78604675 AGGGGCCAGGGGTCTCACTTGGG - Intergenic
909720597 1:78764893-78764915 ATGATCCAGCAATCCCACTGTGG - Intergenic
912117028 1:106419360-106419382 TGGGTCCAGAGGTGCCACTTGGG - Intergenic
915163076 1:153933217-153933239 AGGATCCAGGGGTGTCACTGAGG + Exonic
918911162 1:190572132-190572154 ATGATCCAGTCATCCCACTTTGG - Intergenic
918974018 1:191457256-191457278 ATGATCCAGCAATCCCACTGCGG + Intergenic
922232103 1:223696460-223696482 AGGATCCAACCATCCCACGTAGG + Intergenic
923071580 1:230569995-230570017 ATGATCCAGCAGTTCCACTGAGG - Intergenic
923664560 1:235988504-235988526 ATGATCCAGCAATTCCACTTTGG + Intronic
923995698 1:239491700-239491722 ATGATCCAGCAATCCCACTATGG - Intronic
924445929 1:244130899-244130921 ATGATCCAGCAATCCCACTATGG - Intergenic
1064336936 10:14452028-14452050 ATGATCCAGCAATCCCACTATGG + Intronic
1066042216 10:31560899-31560921 ATGATCCAGCAGTCCCACCTTGG + Intergenic
1068616073 10:59118647-59118669 ATGATCCAGCAATCCCACTACGG - Intergenic
1069335848 10:67349179-67349201 ATGATTCAGCAGTCCCACTCTGG + Intronic
1070553397 10:77509511-77509533 ATGATCCAGCAGTTCCACTTTGG - Intronic
1074703735 10:116113746-116113768 TGGTTCCAGCGGCACCACTTGGG + Intronic
1076328957 10:129651040-129651062 AGGATCCTGGGGACCCTCTTTGG + Intronic
1077410190 11:2400237-2400259 AGGATCCCACGGTCCCGCTCAGG - Intergenic
1077884998 11:6380856-6380878 GGCATCCAGCTGGCCCACTTGGG + Intergenic
1078127272 11:8580091-8580113 ATGATCCAGCAATCCCACTGTGG + Intronic
1078426184 11:11253184-11253206 TGGATCCATCGGTCCCATTTAGG - Intergenic
1082022809 11:47549293-47549315 TTGATCCAGCAATCCCACTTTGG + Intronic
1084114210 11:67032413-67032435 CCCATCCAGCGGTCCCACTCTGG - Intronic
1084286351 11:68133731-68133753 TGGCCACAGCGGTCCCACTTAGG + Intergenic
1085188507 11:74597110-74597132 ATGATCCAGCAGTCCCACTACGG - Intronic
1085294561 11:75423843-75423865 AGGCTCCACCGGTCCTCCTTGGG + Exonic
1087080941 11:94170558-94170580 AGAATCCAGCAATTCCACTTTGG - Intronic
1092050493 12:5466260-5466282 AGGATGCAGCGGACAGACTTGGG - Intronic
1097475158 12:60045591-60045613 ATAATCCAGCAATCCCACTTTGG - Intergenic
1098177679 12:67809879-67809901 AGTATCCAATGGTCCCATTTTGG + Intergenic
1099860906 12:88224545-88224567 ATGATCCAGCAGTTCCACTATGG - Intergenic
1100376609 12:94022084-94022106 AGGATGCTGCTGTTCCACTTCGG - Intergenic
1101706699 12:107227056-107227078 GAGATCCAGCTGTGCCACTTGGG + Intergenic
1103296734 12:119893286-119893308 ATGATCCAGCAATTCCACTTCGG - Intergenic
1112530732 13:100200227-100200249 AGGCTCCAGCAGTCCTACTCAGG - Intronic
1113767536 13:112890468-112890490 AGGACCCAGCCGTCCCACGAGGG - Intergenic
1119314969 14:73685945-73685967 GGGATCCAGCCATTCCACTTCGG - Intronic
1124043058 15:26122646-26122668 GCGATCCAGCAATCCCACTTTGG - Intergenic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1125736145 15:41927276-41927298 ATCATCCAGCAATCCCACTTTGG + Intronic
1127053661 15:55110724-55110746 AGGTTCCAGCTGTGCCACATAGG + Intergenic
1127514348 15:59677179-59677201 AGGATCCAGTGGAACCACATGGG + Intronic
1132057930 15:98666355-98666377 ATGATCCAGCAATTCCACTTTGG + Intronic
1133533562 16:6677666-6677688 TGGATACAGCCGTCCAACTTTGG - Intronic
1135812905 16:25605911-25605933 AGGCACCAGCAGTCCCATTTTGG + Intergenic
1137293795 16:47070856-47070878 ATGATCCAGCAGTCCCACTCTGG + Intergenic
1147918585 17:43902685-43902707 AGGTTCCAGGGCTGCCACTTTGG - Intronic
1150265972 17:63832673-63832695 AGCCTCCAGCAGTCCTACTTGGG + Exonic
1153341067 18:3975550-3975572 ATGATCCAGCAATCCCACTATGG + Intronic
1153700185 18:7684864-7684886 ATGATCCAGCAATCCCACTTAGG - Intronic
1153718510 18:7876591-7876613 AGGATTCAGCCTTCCCAGTTAGG - Intronic
1154146052 18:11867060-11867082 AGGTTCCAGCGTTCACACATGGG - Intronic
1155501569 18:26491944-26491966 GGGATCCAAAGATCCCACTTGGG + Intronic
1159356200 18:67339306-67339328 ATGATCCAGCAGTCCCTTTTTGG + Intergenic
1159993034 18:74933018-74933040 ATTATCCAGCAGTTCCACTTTGG + Intronic
1160214071 18:76911358-76911380 AGGGTCCAGCCCTACCACTTGGG - Intronic
1160920090 19:1515489-1515511 AGGCTCCTGGGGTCCCAGTTGGG + Intergenic
1161506570 19:4647240-4647262 AGGACCCAGCAATTCCACTTTGG - Intronic
1162060905 19:8094602-8094624 AGGATGCAGGGGGCTCACTTGGG + Intronic
1166307284 19:41941828-41941850 AGGATCCAGTTGTCACATTTGGG - Intergenic
1167944566 19:52977642-52977664 AGGACCCAGCGTTCCCTCTGTGG + Intergenic
926385467 2:12331718-12331740 ATGATCCAGCAATCCCACTGTGG + Intergenic
928725459 2:34168465-34168487 ATGATCTAGCAGTTCCACTTCGG - Intergenic
930452742 2:51562660-51562682 ATGATCCAGCAATCTCACTTTGG - Intergenic
931508426 2:62959391-62959413 ATGATCCAGCAATCCCACTTCGG - Intronic
932079015 2:68694476-68694498 AGGATCCAGCAATCCTGCTTTGG + Intronic
933298159 2:80514244-80514266 AGGATCCAGCTGTCCACTTTGGG + Intronic
933810304 2:86028933-86028955 AGAATCCAGCGTGTCCACTTTGG + Intronic
935283113 2:101536528-101536550 AGGACCCAGAGATCCCACTCAGG - Intergenic
935335443 2:102011254-102011276 ATGATCCAGCAGTTCCTCTTTGG - Intronic
936906777 2:117545255-117545277 AGGGCCCAGCAATCCCACTTCGG - Intergenic
937937316 2:127256594-127256616 AGGAAACAGCGCTCACACTTGGG - Intergenic
945162531 2:206907823-206907845 AGGATCCAGCAATCCCCCTGTGG + Intergenic
948978477 2:241479440-241479462 AGCAACCAGCGATCCCACCTGGG - Intronic
1170483896 20:16795464-16795486 AGGATCCAGGGCTCCTAATTAGG - Intergenic
1172381402 20:34495801-34495823 ATGATCCAGCAATCCCACTATGG - Intronic
1173604187 20:44318606-44318628 ATGATCCAGCAATCCCACTCTGG + Intergenic
1174735955 20:52966032-52966054 AGGATCCAGCACTCGAACTTTGG - Intergenic
1176002188 20:62837219-62837241 TGGATACCGCGGTCCCACTGGGG + Exonic
1182366812 22:29784631-29784653 AGGCTCCAGGGGACCCACCTGGG - Intergenic
1184292727 22:43506683-43506705 AGGCTCCAGCAGCCCCACCTTGG + Exonic
950186019 3:10945959-10945981 AGGATCCAGAGGTCTCACTCTGG + Intergenic
954847362 3:53571525-53571547 AGGATCCCGTAGTCTCACTTAGG + Intronic
954926983 3:54244508-54244530 AGGAGCCAGGGTTCCCACTGTGG + Intronic
958132895 3:89452221-89452243 ATGATCCAGCAATCCCACTCTGG - Intronic
958715029 3:97770048-97770070 AAGATCCAGCAATCCCACTGTGG - Intronic
961221470 3:125204209-125204231 ATGATCCAGCAATCCCACTGTGG + Intronic
961325369 3:126106187-126106209 AGGACCCAGCGGCCCCTCTCTGG - Intronic
961583439 3:127902432-127902454 AGGACCCACCGATCCCATTTGGG + Intergenic
962018770 3:131474032-131474054 ATGATCCAGCAATCCCACTATGG + Intronic
963416705 3:145004580-145004602 AAGATCCAGCAATCCCACTATGG - Intergenic
966971804 3:185051323-185051345 AGAATCCAGGGGTTCCACTCTGG + Intronic
973705127 4:53573565-53573587 GGGGTCCAGCTGTCCCGCTTGGG + Intronic
975201642 4:71597134-71597156 AGGATCCAGCGGCCCCCATCTGG - Intergenic
975649266 4:76576123-76576145 ACGATCCAGCAATCCCACTATGG + Intronic
977457532 4:97280536-97280558 ATGATCCAGCAATCCCACTGGGG + Intronic
978321000 4:107495672-107495694 ATGATCCAGCAATTCCACTTCGG - Intergenic
978529979 4:109703243-109703265 AGGAACCCGCGGCCCCACTCCGG + Intronic
978887167 4:113777940-113777962 AGTATTCAGTGGTTCCACTTTGG + Intergenic
983679923 4:170341611-170341633 GTGATCCAGCAGTCCCACTATGG - Intergenic
984013013 4:174392977-174392999 ATAATCCAGCAATCCCACTTTGG - Intergenic
985762966 5:1761071-1761093 AGGATCCAGCAGTGCCTCTGGGG + Intergenic
986066327 5:4237998-4238020 ATGATCCAGCAATCCCACTGGGG - Intergenic
986212703 5:5689357-5689379 ATGGTCCAGAGGTCCCACTCAGG - Intergenic
986877793 5:12132273-12132295 TGGCTCCAGCAGTCCCACCTGGG + Intergenic
987895269 5:23937819-23937841 ATGATCCAGCAATCCCACTGCGG - Intergenic
988242143 5:28627249-28627271 AGAATCCAGCAGTCTCAGTTGGG + Intergenic
989443487 5:41501180-41501202 ATGATCCAACAGTCCCACTTTGG + Intronic
990840020 5:60068085-60068107 ATGATCCAGCAATCCCACTTTGG - Intronic
992954953 5:81898806-81898828 ATGATCCAGCAATCCAACTTCGG + Intergenic
995058691 5:107790677-107790699 AGTATCCAGCAGTCCTAGTTTGG + Intergenic
995289589 5:110435973-110435995 ATGATCCAGCAATCTCACTTTGG - Intronic
995847140 5:116505853-116505875 TGTATCCAGCAGTCCCACATGGG - Intronic
996777478 5:127148262-127148284 TGGATCCAGCAATCCAACTTCGG - Intergenic
998418205 5:141960449-141960471 AGGAGCCAGCCTGCCCACTTCGG - Intronic
999022313 5:148180760-148180782 ATGATCCAGCAATCCCACTCTGG - Intergenic
1001587371 5:172842533-172842555 AGGATCCAGCGGTCCCACTTTGG - Intronic
1003013316 6:2447078-2447100 ACAATCCAGCAATCCCACTTTGG - Intergenic
1003354406 6:5353417-5353439 ATGATCCAGCAGTCCCACTATGG - Intronic
1005563952 6:27069942-27069964 AGCAACCAGAGGCCCCACTTCGG - Intergenic
1010215433 6:73397073-73397095 ATGATCCAGCAGTCTCACTTGGG - Intronic
1010483985 6:76387649-76387671 ATGATCCAGCAATCCCACTATGG - Intergenic
1010531537 6:76973770-76973792 ATGATCCAGCAATTCCACTTTGG + Intergenic
1010675181 6:78735044-78735066 ATGATCCAGCAATCCCACTATGG - Intergenic
1011375869 6:86686425-86686447 AGGATCCAGCTGTTCTATTTTGG - Intergenic
1012164690 6:95933598-95933620 TTGATCCAGCAGTCCCACTGTGG - Intergenic
1012419383 6:99046600-99046622 CTGATCCAGCAGTCCCACTTTGG - Intergenic
1014760002 6:125345933-125345955 AGGATCCAGCATGCTCACTTGGG + Intergenic
1017175499 6:151499961-151499983 AGGATCCAGCAATTTCACTTCGG - Intronic
1018957741 6:168421859-168421881 ATGATCCAGCAATCCTACTTAGG - Intergenic
1023218379 7:37890962-37890984 ATGATCCAGCAATCCCACTATGG - Intronic
1023285099 7:38610943-38610965 ATGATCCAGCAATCCCACTCTGG + Intronic
1026789467 7:73322392-73322414 AGGATCCAGCAGCCCAGCTTGGG - Intronic
1030350219 7:108476612-108476634 ATGATCCAGCAATCCCACTCCGG + Intronic
1030378033 7:108776455-108776477 ATGATCCAGCAATTCCACTTTGG - Intergenic
1030628173 7:111866653-111866675 AGGATCCAGTGGTACAACTAAGG + Intronic
1031838628 7:126709647-126709669 ATGAACCAGCAATCCCACTTTGG + Intronic
1034024564 7:147686097-147686119 AGGAAGCAGAGGTGCCACTTAGG + Intronic
1035384177 7:158459351-158459373 AGAATCCAGAGGCCCCGCTTGGG + Intronic
1037923453 8:22825703-22825725 ATGATCCAGCAATCACACTTTGG + Intronic
1043386872 8:79757536-79757558 AGGAACCTGCGTTCTCACTTTGG + Intergenic
1043642696 8:82476053-82476075 ATGATCCAGCAATCCCACATTGG + Intergenic
1043738686 8:83779069-83779091 ATGATCCAGCAATCTCACTTTGG - Intergenic
1043771472 8:84207142-84207164 ATGATCCAACAATCCCACTTTGG + Intronic
1043781740 8:84345042-84345064 ATGATCCAGCAATCCCACTTTGG - Intronic
1046810198 8:118524891-118524913 AGGAAGCAGGGATCCCACTTAGG - Intronic
1048549979 8:135425221-135425243 AGCTTCCAGCCGTCCCACTGAGG + Intergenic
1049741837 8:144244729-144244751 AGGCTCCAGAGGTCCCACCTGGG - Intronic
1050181750 9:2930521-2930543 ATGATTCAGCAATCCCACTTTGG - Intergenic
1051859002 9:21602758-21602780 ATGACCCAGCAGTTCCACTTGGG - Intergenic
1058211484 9:102174780-102174802 ATGATCCAGCAATCCCATTTTGG - Intergenic
1058363442 9:104178288-104178310 ACAATCCAGCAATCCCACTTTGG - Intergenic
1061282252 9:129604212-129604234 AGGCTCCAGCTGTACCACTGAGG - Intergenic
1062355066 9:136158046-136158068 AGGAGGCAGCCGTCCCACGTGGG + Intergenic
1186514758 X:10158660-10158682 AGCAGCCAGAGGCCCCACTTTGG - Intronic
1186667312 X:11731015-11731037 ATGATCCAACAATCCCACTTTGG + Intergenic
1187044772 X:15636173-15636195 ATGATCCAGCAATCCCACTCTGG + Intronic
1187518089 X:19990779-19990801 AGGATGCGGCGGTCCGACTCGGG - Intergenic
1188173294 X:26955964-26955986 AGGATCCAGTGTTCTAACTTAGG + Intergenic
1188217651 X:27499087-27499109 ATGATCCAGCAGTCCCACTCTGG - Intergenic
1196362100 X:114874300-114874322 ATGATCCAGCAATCCCACTACGG - Intronic
1196932018 X:120691355-120691377 ATGATCCAGCAATTCCACTTTGG - Intergenic
1196994699 X:121369427-121369449 AGGATCCAACAATCCCACTGTGG + Intergenic