ID: 1001590026

View in Genome Browser
Species Human (GRCh38)
Location 5:172858799-172858821
Sequence GGGCCCTGCCCAAGATTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001590021_1001590026 10 Left 1001590021 5:172858766-172858788 CCACAGAAAGAAAACAGGGCTGG 0: 1
1: 0
2: 4
3: 49
4: 387
Right 1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG 0: 1
1: 0
2: 2
3: 16
4: 198
1001590018_1001590026 20 Left 1001590018 5:172858756-172858778 CCGCTGTTGTCCACAGAAAGAAA 0: 1
1: 1
2: 2
3: 26
4: 311
Right 1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG 0: 1
1: 0
2: 2
3: 16
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001590026 Original CRISPR GGGCCCTGCCCAAGATTCCA AGG Intronic
900168826 1:1256417-1256439 TGGCCCACCCCAAGATCCCAAGG + Intronic
900524267 1:3120794-3120816 GAGCCCTGGCCAAGAGTGCAAGG + Intronic
900798100 1:4721525-4721547 CGTCCCTGGCCAAGATTTCATGG + Intronic
901329939 1:8398759-8398781 AGGCCCTGTGCCAGATTCCATGG - Intronic
901641946 1:10697070-10697092 GGGCCCTGCCCAAGAGGAAAAGG + Intronic
902096457 1:13949994-13950016 GGCCCCTACCCACCATTCCAAGG - Intergenic
902604035 1:17558898-17558920 GGGCCCTTCCCCAGCTTCCTCGG + Intronic
903652930 1:24932235-24932257 GGGCCCTGCGCCAGGTGCCAGGG - Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906675990 1:47694078-47694100 GGGTCCTTACCAAGATGCCATGG + Intergenic
920185050 1:204154280-204154302 AGGCCTTGCCCAAGATTACTCGG - Intergenic
920269094 1:204749920-204749942 GGGCCCTGGGCAAGATTTCTGGG + Intergenic
922034511 1:221835432-221835454 GAGCCCTCCCACAGATTCCAGGG + Intergenic
923008542 1:230070639-230070661 GGCCCTTGCCCGAGAGTCCAAGG + Intronic
923039406 1:230309014-230309036 TGGCCATGCCCAAGAAACCATGG - Intergenic
924379948 1:243453309-243453331 GGCCCCAGCCCAAGACTGCAGGG + Intronic
1063204816 10:3820886-3820908 GGGCCCTTCCTCAGATCCCACGG + Intergenic
1067769615 10:49114099-49114121 TGGCCCTGCCCACCAGTCCAAGG + Intronic
1068492964 10:57747153-57747175 AGGCCTTGTCAAAGATTCCATGG - Intergenic
1070649627 10:78225548-78225570 GGCCCTTGTCCAAGATTGCAGGG + Intergenic
1070845778 10:79521866-79521888 GGCCCCTGGCCAAGCCTCCAAGG - Intergenic
1070928015 10:80238452-80238474 GGCCCCTGGCCAAGCCTCCAAGG + Intergenic
1070982143 10:80657645-80657667 GGGGCCTCCCCAAGAGTCCTTGG + Intergenic
1074118338 10:110474605-110474627 AGGCCCTGCCCTGGCTTCCAGGG - Intergenic
1074884910 10:117685834-117685856 GGGCCCTGCCCTACATGCCTGGG - Intergenic
1074895422 10:117773261-117773283 GGACCGTGCCCATGCTTCCATGG + Intergenic
1076171327 10:128322538-128322560 AGGACTTGCCCAAGGTTCCAAGG - Intergenic
1076433603 10:130424558-130424580 AGGCCCTCCCCCAGCTTCCAGGG - Intergenic
1077083942 11:738216-738238 GGGCCCTGCCCCACACCCCAGGG - Intergenic
1077516065 11:3002823-3002845 TGGCCCTGCCCTAGATGCAAAGG + Intronic
1077878593 11:6328781-6328803 GGGGCTTGGCCATGATTCCATGG + Intergenic
1078003001 11:7513053-7513075 TGGCCCTGCCCAGGCCTCCAAGG - Intergenic
1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG + Intronic
1079356636 11:19735365-19735387 AGGCCCTGCCTAGGATGCCAAGG - Intronic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1080305735 11:30833094-30833116 GGGCCCTGGGCACCATTCCATGG - Intronic
1081717769 11:45263052-45263074 AGGCCCTGCCCACCATTCCCTGG + Intronic
1084863586 11:72038649-72038671 GGGGCCTGCCTCAGATTTCAGGG - Intronic
1084870720 11:72097007-72097029 GGGCCCTGCCTCAGACTCAATGG - Intronic
1085108748 11:73868710-73868732 TGGCCATTCCCAGGATTCCATGG - Intergenic
1085374150 11:76042900-76042922 GGGCCTTGCCCAATTTTCTAAGG + Intronic
1088183992 11:107143130-107143152 GGGCTCTGCCTAAGGTTCCAGGG + Intergenic
1088627672 11:111742975-111742997 GCCCCCTGCCCAAGGTTCAAGGG + Intronic
1088831074 11:113537366-113537388 GAGCCCTGCCTAGGACTCCAGGG - Intergenic
1089600547 11:119611770-119611792 GAGACCTGCCCTAGATTCTATGG - Intergenic
1090802265 11:130180286-130180308 GGTCCCTCCCCAGGATTCCAAGG + Intronic
1091768533 12:3137282-3137304 GGGCCCTGCCCACGTTTCCCCGG + Intronic
1095192333 12:39271943-39271965 TGGCCCTGCCCATTATTCCTAGG + Intergenic
1095512626 12:42969644-42969666 AGGCCCTAGCCATGATTCCATGG + Intergenic
1101952452 12:109187221-109187243 GGGCCCTGCCCAGGATGCCCTGG + Intronic
1102577327 12:113864109-113864131 GTGACTTGCCCAAGGTTCCATGG + Intronic
1104044877 12:125154640-125154662 GGAACTTGCCCAAGATCCCATGG + Intergenic
1106580729 13:31016284-31016306 GGGCAGAGCCCCAGATTCCATGG + Intergenic
1107567680 13:41622744-41622766 GGGCCTTGCCCAGAATTACAGGG - Intronic
1108267797 13:48729977-48729999 GGGCTCTGCCTGAGATACCAGGG - Intergenic
1112629853 13:101148651-101148673 GGGCTCTGCTCATTATTCCACGG + Intronic
1112922037 13:104625802-104625824 GAGCCTGGCACAAGATTCCACGG + Intergenic
1114132621 14:19809931-19809953 AGGCCCTGGCTAAGATTTCATGG + Intronic
1114525251 14:23364096-23364118 AGGTCCTGCCTAAGATTCCCAGG - Intronic
1117055825 14:51911119-51911141 AGCCCCTGCCCCAGCTTCCAGGG - Intronic
1119548547 14:75491500-75491522 AGCCCCTGCCCTAGATCCCACGG - Intergenic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1121266214 14:92604159-92604181 GGGCCATGCCCACTCTTCCATGG - Intronic
1125738266 15:41943654-41943676 GGCCCCTGCCCAAGCATCCTGGG + Intronic
1127148964 15:56054368-56054390 GGGGCCTGCCCAGGAATCTAGGG + Intergenic
1127960803 15:63888891-63888913 GAGACCTGCCCAAGGTTACATGG + Intergenic
1131074230 15:89484882-89484904 AGGCCCTGCCCAAGCTTCCTCGG - Intronic
1132714711 16:1284882-1284904 GGGCCCTCTCCACTATTCCAGGG + Intergenic
1132714724 16:1284922-1284944 GGGCCCTCTCCACTATTCCAGGG + Intergenic
1132714764 16:1285022-1285044 GGGCCCTCTCCACTATTCCAGGG + Intergenic
1132714797 16:1285102-1285124 GGGCCCTCTCCACTATTCCAGGG + Intergenic
1132714812 16:1285142-1285164 GGGCCCTCTCCACTATTCCAGGG + Intergenic
1132714836 16:1285202-1285224 GGGCCCTCTCCACTATTCCAGGG + Intergenic
1132714849 16:1285242-1285264 GGGCCCTCTCCACTATTCCAGGG + Intergenic
1132714862 16:1285282-1285304 GGGCCCTCTCCACTATTCCAGGG + Intergenic
1132989247 16:2784701-2784723 GTGCCCTGCCCAACCGTCCAGGG - Exonic
1134675849 16:16090124-16090146 GACCCCTGCCCCAGATTCCAGGG - Intronic
1136402435 16:30025860-30025882 GGGGGCTGCCCAAGAACCCAGGG - Intronic
1139214424 16:65113383-65113405 AGGACTTGCCCAAGATCCCACGG - Intronic
1141289106 16:82701236-82701258 GGGCCATGCCCAAGGTTGAAAGG - Intronic
1141553558 16:84821972-84821994 GGGCCCTGCCCCAGATTCTGGGG + Intronic
1141812195 16:86383158-86383180 AGACCCTGCCCAAGATCCCCCGG + Intergenic
1142638536 17:1271890-1271912 AGGCCCCGCCCAGCATTCCAAGG - Intergenic
1143055022 17:4156232-4156254 GGCCCCTGCCCAAGATAGGAGGG + Intronic
1144772976 17:17770000-17770022 GGGCCCTGCCCAGGGTGACAGGG + Intronic
1144947910 17:18979192-18979214 GGGCGCTGCCCATGGTTACATGG - Intronic
1145897898 17:28471197-28471219 GGGCCCTGGCCATGACTCCCAGG + Intronic
1147807548 17:43142536-43142558 GTGACCTGCCCAAGTGTCCAAGG - Intergenic
1150327925 17:64271690-64271712 AAGGCCAGCCCAAGATTCCAAGG - Intergenic
1151342544 17:73481177-73481199 GGGCCCTCCCCCACCTTCCAAGG - Intronic
1151848468 17:76674703-76674725 GGGCCCAGCCCCAGGCTCCAGGG + Exonic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1153746659 18:8186574-8186596 GGGCCATGCACAAGAGTGCAGGG - Intronic
1154038779 18:10833419-10833441 GGGCCCTGCCCCAGAACCCCTGG + Intronic
1154245812 18:12696672-12696694 GGGCAGTGTGCAAGATTCCAAGG + Intronic
1157474000 18:48009805-48009827 GGGCCCTGCCCAAAGGTCCTGGG - Intergenic
1157689446 18:49668971-49668993 TGGCTCTGCCCAAGATAACAAGG - Intergenic
1158379341 18:56912041-56912063 GGGGCTTGCCACAGATTCCAGGG - Intronic
1161904008 19:7141648-7141670 GGGGCATGCCCAAGAGTCAAGGG + Intronic
1163630035 19:18413609-18413631 GGGCCCTTCCCCAGCTCCCATGG - Intergenic
1164580640 19:29432958-29432980 AGTCCCTGCCCCAGAATCCATGG + Intergenic
1166873849 19:45885709-45885731 GCGACCTGCCCAAGATGCCGTGG - Exonic
1168545371 19:57245339-57245361 GGGGCCTCCCCAAGATTCGGTGG - Intronic
925894495 2:8460931-8460953 GGGTCCTGCCCAAGAGTACCAGG + Intergenic
926167495 2:10530652-10530674 AGGCCCTGCCCAAGAGGCCCTGG - Intergenic
927382753 2:22498115-22498137 GAGCCCTGCCCAAGACTTCATGG - Intergenic
927885790 2:26717736-26717758 GGGCCCTGCCCAGGACCCCCAGG + Intronic
927915656 2:26934447-26934469 GGGACCTGCCCAAGCTCACAGGG - Intronic
928170091 2:28998015-28998037 GGTCCCTGCCCAAAAAACCAAGG - Intronic
928200391 2:29244235-29244257 GGGCCTTGCCCAGGATCCCACGG - Intronic
928372538 2:30751291-30751313 TGGCCCTGCCCAGGAGTCCCAGG - Intronic
929536311 2:42786614-42786636 GTGCCCTGTCCAAGATCCCGGGG + Intronic
929913572 2:46114709-46114731 GTGCCCAGCCCCAGAGTCCAAGG + Intronic
932281006 2:70491782-70491804 CTGCCCTGTGCAAGATTCCATGG + Intronic
932343627 2:70982026-70982048 CGTCCATGCCCAAGATGCCATGG + Exonic
934043351 2:88148027-88148049 GTGCCCTGCCCAGGGGTCCAAGG + Intergenic
935276641 2:101481013-101481035 GGGCACTGCCTTAGAGTCCATGG + Intergenic
936591174 2:113806176-113806198 GGACCCTGGCCAACATTACATGG - Intergenic
937084788 2:119164039-119164061 GGGCCCTGCCCAAGAAGAAAAGG - Intergenic
938164019 2:129010424-129010446 GTGCCCTGGCCAGGCTTCCACGG - Intergenic
938694881 2:133826187-133826209 GGGCCCTGCACACTATGCCAGGG - Intergenic
944085721 2:195845940-195845962 AGGCCCTGGCCAAGATTAAATGG + Intronic
945487399 2:210413195-210413217 TGGCCCTGGCAAAGATTTCATGG - Intergenic
947794782 2:232887428-232887450 TGGCCCTGCCCAAGAGCCCTGGG - Intronic
948294876 2:236853245-236853267 GGGCCCTGCCCACCACTGCAGGG + Intergenic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1169353814 20:4891508-4891530 GGCCTCTGCCATAGATTCCAGGG + Intronic
1170509445 20:17061361-17061383 GTGCCTTGGCCAAGATCCCAAGG + Intergenic
1172822881 20:37753973-37753995 GGGGCTTGCACAAGATTACATGG + Intronic
1172832195 20:37845482-37845504 GGGCACTGGCAAACATTCCAAGG + Intronic
1173184907 20:40833208-40833230 GGGCCCTGCTCCAGATGCCCTGG - Intergenic
1173523648 20:43716512-43716534 GGGCCCTGCTCATGGTTCCCTGG + Intergenic
1174177492 20:48654129-48654151 GGGACTTGCCGAAGGTTCCAGGG - Intronic
1175370240 20:58483409-58483431 TGGCACTGCCCACCATTCCAGGG + Intronic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1179481373 21:41680929-41680951 GAGCCTTGCCCTAGATTCCGTGG + Intergenic
1179582586 21:42352761-42352783 GGGGCCTGAGCAGGATTCCAGGG - Intergenic
1181815043 22:25431041-25431063 GGGGCCTGCCCAAGCTCACATGG + Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1184742740 22:46438442-46438464 GGTGCCTCCCCAAGCTTCCAGGG - Intronic
950880189 3:16317016-16317038 GGGCCCTGTCCAAGAGGACAAGG - Exonic
957420884 3:79968040-79968062 AGGCCAGGCTCAAGATTCCAGGG - Intergenic
958906696 3:99949566-99949588 GTGCCCTGAGAAAGATTCCAAGG - Intronic
962380758 3:134896823-134896845 AGGCCCTGCCCAAGAGCCCTTGG + Intronic
963575761 3:147059291-147059313 AGGCGCTGCCCAAGAGTCCCAGG - Intergenic
963968768 3:151405379-151405401 GTTCCCTGCTCAAGCTTCCATGG - Intronic
964637448 3:158872693-158872715 AGCACCTGCCCAAGATTTCATGG + Intergenic
965295428 3:166939459-166939481 AGGCCCTGGCAAAGATTTCATGG - Intergenic
965893224 3:173540601-173540623 TGGCCCTGCTTAAGATTTCATGG - Intronic
966799038 3:183745147-183745169 GGCCCCTGCCCACTATTCCTAGG + Intronic
967943709 3:194786044-194786066 TGGCCCTGCCCAAATTTCCTGGG - Intergenic
968764507 4:2461256-2461278 GGGCCCTGGCCTAGTTCCCAGGG + Intronic
969213575 4:5706805-5706827 GGGACGTGCTCAAGATGCCAAGG + Intronic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
972727097 4:41754284-41754306 GAGCCCTGACCAAGCTTGCAGGG + Intergenic
972759217 4:42085676-42085698 GGGCCCGGCCCAAGAATATATGG + Intronic
974515873 4:62909327-62909349 GGGGATGGCCCAAGATTCCAAGG - Intergenic
981773432 4:148336584-148336606 GGGGCCTTGCAAAGATTCCATGG - Intronic
981922532 4:150100895-150100917 GGGCACTGCCCAAGATAACTGGG - Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
993033972 5:82736758-82736780 AGGCCTTGCCCAATTTTCCAAGG - Intergenic
997232254 5:132253613-132253635 TGGCCCTGAGCCAGATTCCAGGG - Intronic
997447380 5:133951538-133951560 GGGCCCTTCCCATCATTCCCTGG - Intergenic
997624775 5:135324310-135324332 AGGCCCGGCCCAATATTCCCGGG - Intronic
1000163702 5:158626528-158626550 GTGCCCTGCACAAGAATCCCTGG - Intergenic
1001044383 5:168360729-168360751 GGGCCCCTCCCAAGACTGCATGG - Intronic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1001412413 5:171520540-171520562 AGGCCCTGCCCAAGGCCCCATGG - Intergenic
1001426742 5:171627900-171627922 GGGTCCTGCCCCAGGGTCCAGGG - Intergenic
1001512921 5:172336414-172336436 GGGCCCTGCCCAAGCCTCTCTGG + Exonic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1002097070 5:176837681-176837703 GGGCCCTTTCCAAGCTGCCATGG + Intronic
1005398783 6:25410460-25410482 GTTACCTGCCCAAGATTGCATGG + Intronic
1006188574 6:32193978-32194000 GAGATCTGCCCAAGATTGCAAGG - Intronic
1006803556 6:36774632-36774654 GGGAAGTGCCCAGGATTCCAGGG - Intronic
1007234435 6:40380050-40380072 GGTCCCTGCCTAAGATAACAAGG - Intergenic
1009788408 6:68367685-68367707 GGGCCCTGCATAAAGTTCCATGG - Intergenic
1010647070 6:78402246-78402268 AGGCCCTGGCAAAGATTTCATGG - Intergenic
1018707199 6:166471435-166471457 TGGCCCTGGCCAAGCTTCCAGGG - Intronic
1019160175 6:170064109-170064131 GGTCCCAGTCCAAGAATCCATGG + Intergenic
1019565366 7:1676279-1676301 GGGCCCTTCCACAGCTTCCACGG - Intergenic
1020059916 7:5144273-5144295 GTGCCCTGCGCGAGCTTCCAGGG + Intergenic
1022208733 7:28187654-28187676 GGGCCCGCCCCCAGATTCAAGGG - Intergenic
1023863494 7:44228395-44228417 GGGCCCTGCCCATGGTGCCCAGG - Intronic
1024230701 7:47361232-47361254 GGGCCCAGCCCAAGACCCCAAGG + Intronic
1026958544 7:74393899-74393921 GGACCCTGGCCAGGGTTCCAGGG + Intronic
1026958694 7:74394814-74394836 GGCCCCTGGCCAGGGTTCCAGGG + Intronic
1029493632 7:100885480-100885502 GGCCCCTTCCCCAGGTTCCATGG + Intronic
1029993141 7:104980354-104980376 AGGCCCAACCAAAGATTCCAGGG + Intergenic
1032128388 7:129210895-129210917 TGGCCCTTCCCAAGATTTGATGG + Intronic
1032708985 7:134446428-134446450 GGGGCCTGCCCAAGAGCCCCAGG + Intronic
1034840706 7:154392837-154392859 GGGCCCTCCCCAAAGTCCCATGG + Intronic
1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG + Intergenic
1035282218 7:157785421-157785443 GAGCCCTGCCCCAGGCTCCAAGG - Intronic
1035282758 7:157787803-157787825 GGGCCCCGTCCAAGCTGCCAAGG + Intronic
1037468243 8:19182076-19182098 GGGCCTTTCCCAAGACCCCAGGG - Intergenic
1037855907 8:22370469-22370491 GTCCCCTGCTCAACATTCCATGG - Intronic
1039341972 8:36660295-36660317 GGGCCATGCCAAATATGCCATGG + Intergenic
1043967946 8:86500114-86500136 AGGCCCTGGCAAAGATTTCATGG + Intronic
1047704247 8:127481784-127481806 TGGCACTGCCCAAGATGCCAGGG + Intergenic
1049954287 9:677874-677896 TAGCCCTGCCCAATATTTCACGG - Intronic
1051334376 9:16053277-16053299 GGGCGCTGCCCAAGAGTCAGTGG - Intronic
1052325921 9:27216716-27216738 CAGCCCTGCCCTAGATCCCAAGG - Intronic
1055868830 9:80849408-80849430 GGGCCCTTCTGAAGAATCCAGGG + Intergenic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1057216222 9:93230319-93230341 AGGCCCTGCCCAAGGCTGCAGGG - Intronic
1057782981 9:98064996-98065018 GGCCCCTGCCCCAGGTTGCAGGG - Intronic
1060399468 9:123339890-123339912 GGCGCCTGCCCACGAATCCATGG + Intergenic
1060399569 9:123340419-123340441 GGGCCCTGAACTAGATGCCATGG + Intergenic
1062353673 9:136151973-136151995 GGGCCTTTCCCAATATCCCAGGG - Intergenic
1062431880 9:136529994-136530016 GGGCCCTGCCCTGGCTCCCAGGG + Intronic
1186640190 X:11447627-11447649 GGCCCCTGCCTTAGATTCCTGGG + Intronic
1187268090 X:17755595-17755617 GGGCCCTGACCGAGGCTCCAGGG + Intergenic
1188568482 X:31553364-31553386 GGGCCCTACCCAAGACTGCATGG - Intronic
1188903804 X:35767153-35767175 TGTCCCTGCTCAAGATTCCTTGG + Intergenic
1192351696 X:70361312-70361334 GGGCCTTGCCCCAAATGCCATGG + Intronic
1201529664 Y:14977991-14978013 GGGGCCTGCCAGAGATTCCAAGG + Intergenic