ID: 1001590543

View in Genome Browser
Species Human (GRCh38)
Location 5:172861476-172861498
Sequence CAGGCTCCATTGATGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001590543_1001590549 5 Left 1001590543 5:172861476-172861498 CCCAGTGCCATCAATGGAGCCTG 0: 1
1: 0
2: 0
3: 21
4: 195
Right 1001590549 5:172861504-172861526 TGTGGATGCTGACTACTCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001590543 Original CRISPR CAGGCTCCATTGATGGCACT GGG (reversed) Intronic
900740750 1:4329317-4329339 CAGGCTCCATTCCTGGCCCCTGG - Intergenic
900968369 1:5975393-5975415 CAGGCTCCATGAATAGCACGGGG + Intronic
904030398 1:27529812-27529834 CAGGCACCGTCGAAGGCACTTGG - Intergenic
904942892 1:34177321-34177343 CTGGCACCATTGTAGGCACTCGG - Intronic
904976179 1:34458475-34458497 CAGGCTCCATCCAAGACACTGGG + Intergenic
904982932 1:34522033-34522055 CAGGCTCTTTTGATGGCTCCAGG - Intergenic
905009230 1:34735917-34735939 ACTGCTCCATTGCTGGCACTTGG + Intronic
907112041 1:51935347-51935369 CAGGCCCCATTCTGGGCACTGGG + Intronic
907355186 1:53866571-53866593 CAAGATCCAATGAAGGCACTAGG + Intronic
907490436 1:54805824-54805846 CAGGCTCCATGCAGGGCTCTGGG + Intergenic
909597496 1:77422746-77422768 CAGGCTCCGTGGCAGGCACTGGG - Intronic
912132636 1:106620613-106620635 CAGCTTCCATGGCTGGCACTGGG - Intergenic
912738896 1:112175250-112175272 CTGGGTCTATTGATGTCACTTGG - Intergenic
915110882 1:153564119-153564141 AAGCCTCCTCTGATGGCACTTGG + Intronic
915721349 1:157988115-157988137 CAGGCTCCATGGATGGGGCATGG - Intergenic
917732993 1:177894977-177894999 CAGGCACCATTGTTGGCTCAAGG - Intergenic
918533535 1:185549367-185549389 CTGTCTCCATAAATGGCACTTGG - Intergenic
918629888 1:186704162-186704184 CTGGCTCCTTCGAAGGCACTGGG - Intergenic
919807104 1:201386612-201386634 CTGGCCCCAGGGATGGCACTGGG - Exonic
922068453 1:222167336-222167358 CAGGCCCCATTTTGGGCACTGGG - Intergenic
922653116 1:227357980-227358002 CAGGCTGCAACCATGGCACTTGG + Intergenic
923695064 1:236240694-236240716 CAGGCACCATTCTAGGCACTAGG + Intronic
924258372 1:242204651-242204673 CATGCTGCAGTGATGGCACTAGG + Intronic
1062853103 10:760219-760241 CAGGCCCCAGTGGTGGCAGTGGG - Intergenic
1063465802 10:6243523-6243545 CTGCCTCCACTGATGGGACTAGG - Intergenic
1068369531 10:56095350-56095372 CAGCCTCCACTGGTGACACTTGG - Intergenic
1070801215 10:79245412-79245434 CAGGCACCACAGTTGGCACTGGG - Intronic
1070816827 10:79329596-79329618 CAGGCTCTATTCCAGGCACTAGG - Intergenic
1072091407 10:92131318-92131340 CAGCCTCCATAGATAGCTCTTGG - Intronic
1074423880 10:113333772-113333794 CAGGTTCCATGGCAGGCACTGGG + Intergenic
1075153350 10:119954829-119954851 CAGGCTCTGTTCCTGGCACTTGG + Intergenic
1076810657 10:132884784-132884806 CAGGCTCCCCTGGTGGCACCAGG - Intronic
1076996672 11:300431-300453 CAGGGTCTATTGTTGGCACGTGG - Intergenic
1077378168 11:2215341-2215363 CAGGCTCCACTCTGGGCACTGGG + Intergenic
1078249969 11:9608833-9608855 CAGGCACCATTCTGGGCACTGGG + Intergenic
1080296130 11:30730190-30730212 CATGCACCGTTGGTGGCACTTGG + Intergenic
1080579738 11:33632444-33632466 CAGGCCCCATCGATGGAGCTGGG + Intronic
1081782210 11:45721097-45721119 CAGGCTCTATTGAAGACACTTGG + Intergenic
1084434827 11:69132564-69132586 CAGCCTCCCTGGGTGGCACTGGG + Intergenic
1085183944 11:74559611-74559633 CAGGGACCTTTGATGGGACTAGG + Intronic
1086070818 11:82797152-82797174 CAAGCTCCATGGCTGGCCCTGGG + Intergenic
1087338831 11:96877612-96877634 CAGCTTCCATGGCTGGCACTGGG + Intergenic
1088908257 11:114170963-114170985 TAGGCCCCAATGAAGGCACTGGG - Intronic
1090441204 11:126727101-126727123 CAGGCTCCATGCTAGGCACTGGG - Intronic
1090514524 11:127411525-127411547 CAGCTTCCATGGCTGGCACTGGG + Intergenic
1090777190 11:129975816-129975838 CAGGCACCTTGGAAGGCACTTGG - Intronic
1090824158 11:130372004-130372026 CAGGCACCATATATGGCCCTGGG - Intergenic
1094105611 12:26808200-26808222 AGGGCTCCATTGATGACACCAGG - Intronic
1095931819 12:47635374-47635396 TGGTCTCCATTGATGCCACTGGG - Intergenic
1097380513 12:58890102-58890124 CAGGTTCCATTGATGTGACTCGG + Exonic
1098602323 12:72346642-72346664 CAGGCTCTAAGGTTGGCACTCGG - Intronic
1098802893 12:74984919-74984941 CAGCTTCCACAGATGGCACTAGG + Intergenic
1100296333 12:93265486-93265508 CAGGCTCTATGCAGGGCACTTGG + Intergenic
1100817188 12:98397702-98397724 CAGTCTCCATTGTGGCCACTGGG - Intergenic
1101104886 12:101429958-101429980 TAGTATCCATTGCTGGCACTTGG + Intergenic
1102469408 12:113151130-113151152 CAGGCACCCTTGTAGGCACTGGG - Intronic
1102782886 12:115580778-115580800 CAGGCTCCATTGCAAGCACTTGG + Intergenic
1103134433 12:118495451-118495473 CAGTCTCCATTTTAGGCACTGGG + Intergenic
1103993357 12:124813955-124813977 CAGGCTCAAATGATGTGACTGGG - Intronic
1105617403 13:22031251-22031273 AAGGCTCCATTTATGGCAGGAGG + Intergenic
1106448995 13:29862861-29862883 GAGGCACCATGGATGGCAATTGG - Intergenic
1106557156 13:30819395-30819417 CAGGCACCATGGATGTGACTGGG - Intergenic
1109211439 13:59539659-59539681 AAGGCTCCATTGATGGATCTGGG + Intergenic
1109633743 13:65085974-65085996 CAGGCACCATGAATGGCAGTAGG - Intergenic
1112253507 13:97806281-97806303 CAGGCACCATTCTAGGCACTGGG + Intergenic
1115228393 14:31129429-31129451 CAGGCTGGATTGATGTCACCTGG - Exonic
1117734115 14:58751895-58751917 CAGCTTCCATAGCTGGCACTGGG - Intergenic
1117766875 14:59092745-59092767 CAGGCTCCATTCTAGGCACTGGG - Intergenic
1118132466 14:62982370-62982392 TTGGCTTCATTGATGGCACAGGG - Intronic
1118600005 14:67465357-67465379 CAGTCTCCCTGGATGGCACAGGG + Intronic
1120895849 14:89531556-89531578 AATGCTCCAGTGATAGCACTGGG - Intronic
1126477163 15:49077620-49077642 CAGGCACCATTGAAGACACTGGG - Intergenic
1126492772 15:49258160-49258182 CAGGCACTATTCCTGGCACTGGG + Intronic
1127899773 15:63332486-63332508 CAGGTTACAATGCTGGCACTTGG + Intronic
1128965399 15:72052675-72052697 CAGCTTCCATGGCTGGCACTGGG - Intronic
1129705282 15:77790763-77790785 AAGTCTCCATGGATGGCTCTAGG - Intronic
1132715619 16:1288659-1288681 CAGGCTCCACTCATGGCCCAAGG + Intergenic
1133206490 16:4237310-4237332 CAGGTTCCATTGAGGTCACTGGG - Intronic
1133845297 16:9447920-9447942 CAGGCTCCGTTCTTGGCACTGGG + Intergenic
1133857808 16:9565994-9566016 CAGGCGCCATTCTAGGCACTGGG - Intergenic
1134773590 16:16832369-16832391 CAGGCACCATGCAAGGCACTGGG + Intergenic
1135829103 16:25757852-25757874 CCAGCTCCCTTGATGGCACCTGG + Intronic
1138821824 16:60269576-60269598 GAGGCTCCAGTGAGGGCACAAGG - Intergenic
1139625726 16:68187205-68187227 CAGCTTCCATGGCTGGCACTGGG + Intronic
1139666574 16:68461179-68461201 CAGGCACCATTCTAGGCACTGGG - Intergenic
1141247073 16:82317912-82317934 CAGGCTACATTCCAGGCACTGGG - Intergenic
1141648370 16:85379340-85379362 CAGGCACCATTCTAGGCACTGGG - Intergenic
1143322637 17:6078055-6078077 CAGGCTTCATCCATGGCTCTGGG + Intronic
1145038885 17:19561668-19561690 GAGGCTCCACTGATGTTACTTGG + Intronic
1145859844 17:28200386-28200408 CAGACACCATTGTTGGCTCTAGG + Intergenic
1146425403 17:32732933-32732955 CAGCTTCCATGGCTGGCACTGGG - Intronic
1146645467 17:34574175-34574197 CAGGCACCATTCTGGGCACTGGG + Exonic
1148077779 17:44949014-44949036 GAGGCTCCCCTGATGGCTCTTGG - Intergenic
1149519518 17:57307959-57307981 CAGGCTCTATGGAAGGCACTTGG - Intronic
1151542616 17:74772316-74772338 CAGGCTCCAGTGCGGGCACTTGG + Intronic
1152864109 17:82712034-82712056 CAGGTTCCATGGCTGGCACGGGG + Intergenic
1153047656 18:871443-871465 CTGGGTAGATTGATGGCACTGGG - Intergenic
1155205115 18:23551929-23551951 CATGTGCCATTGATGGCACTGGG - Intronic
1156662337 18:39360184-39360206 CAGACTCCATTGAAGGTAATAGG - Intergenic
1157136245 18:45058785-45058807 CAATCTCCATTGATGGCATCAGG - Intronic
1157172714 18:45422700-45422722 CTGGCTCCATTGATGGAGCAGGG - Intronic
1158411347 18:57208652-57208674 CAGGCTCCATGGCTGGCACATGG + Intergenic
1162088373 19:8262039-8262061 CAGCCCCCACTGATGGCCCTCGG + Exonic
1162150023 19:8638545-8638567 CAGGCTCCATTCCAAGCACTGGG + Intergenic
1164882375 19:31743820-31743842 CAGTCTCCTTTGCTGGCACTGGG + Intergenic
1165075497 19:33277933-33277955 CAGGCTGCCTTTATGACACTGGG + Intergenic
1166133067 19:40758347-40758369 CAGGCGCCATTCAAGGCTCTGGG - Intronic
1166648571 19:44552467-44552489 CAGTGTCCATTGAGGCCACTAGG + Intergenic
1167550184 19:50154921-50154943 CAGGCGCCATTGTAGGCATTTGG + Intronic
925048289 2:790791-790813 CAGCTTCCATGGCTGGCACTGGG - Intergenic
926357893 2:12057678-12057700 CAGACTCAATTGATGGCCTTGGG + Intergenic
926424994 2:12732190-12732212 CAGGCACCATGGATGGGAGTCGG + Intronic
928383754 2:30846483-30846505 CAGGCTCTATAGGAGGCACTTGG + Intergenic
928909712 2:36407090-36407112 CAAGTACCTTTGATGGCACTTGG - Intronic
929885206 2:45871987-45872009 CAGGCACCATGGGAGGCACTGGG + Intronic
931655834 2:64510876-64510898 CAGGCTCCATTCATTGCATCAGG - Intergenic
933777107 2:85777779-85777801 CAGGCTCCACTGGAGGCTCTGGG - Intronic
936287756 2:111194258-111194280 CAGGCACCATTCTAGGCACTAGG + Intergenic
937100355 2:119263824-119263846 CATGCTCCAGGGATGGCTCTGGG - Exonic
937296102 2:120810811-120810833 GAGGCTCCAGTGACGTCACTGGG + Intronic
938039628 2:128065111-128065133 CAGGCTCAATGGCTGGCCCTTGG - Intergenic
942584936 2:177465678-177465700 CAGCTTCCATTGGTGGCACCAGG + Intronic
943199186 2:184797205-184797227 AATACTCCACTGATGGCACTAGG - Intronic
945525620 2:210884894-210884916 CAATGTCAATTGATGGCACTTGG - Intergenic
945855367 2:215062959-215062981 CAGGCACCATTCTAGGCACTGGG - Intronic
948815579 2:240508689-240508711 CAGGCACCATTCTAGGCACTAGG - Intronic
1169331436 20:4719569-4719591 CAGGTTCCATTGCTGGCCCATGG - Intergenic
1171190025 20:23152136-23152158 CAGGATCCAGTGATGGCTTTCGG - Intergenic
1172974327 20:38894887-38894909 CATGCTGCAGTGATGGCACGTGG - Intronic
1174870856 20:54180667-54180689 CAGGCACCATTCCTAGCACTAGG + Intergenic
1175045954 20:56105985-56106007 CAGTCTCCCTTGATGCGACTGGG - Intergenic
1175214191 20:57381975-57381997 CATGCTCCAATGTTGGCATTGGG - Intergenic
1177443463 21:21159435-21159457 CAAGCTCCATTTATGGTAATTGG + Intronic
1178278239 21:31258215-31258237 CAGGCTTTATTCTTGGCACTTGG - Intronic
1179010513 21:37552653-37552675 CAGCTGCCACTGATGGCACTGGG - Intergenic
1182551262 22:31102013-31102035 CAGGCTCCTGTGTGGGCACTGGG + Intronic
1184894132 22:47397274-47397296 AAGGCCCCTTTGATGACACTGGG + Intergenic
949168438 3:968985-969007 CAGGCACTATTCTTGGCACTTGG + Intergenic
949878496 3:8642816-8642838 CAGGCTCCCTTTCTGACACTTGG + Intronic
950363335 3:12465354-12465376 TCGGCTCCCTTGAAGGCACTTGG - Intergenic
950434543 3:12970897-12970919 CAGGCTCCACTGTCGGCACAGGG - Intronic
950454916 3:13086943-13086965 CAGGCCCCATTCAGTGCACTGGG - Intergenic
952750633 3:36822034-36822056 CAGGATCCCTTCAGGGCACTAGG + Intergenic
953289951 3:41650466-41650488 CAGCCTCCACTGTGGGCACTGGG - Intronic
955346408 3:58165042-58165064 CAGGCAGCAGTGCTGGCACTTGG + Intronic
960180299 3:114567905-114567927 GGGGTTCCATTGATAGCACTTGG + Intronic
960988556 3:123295937-123295959 CAGGCCCCATCGAAGCCACTTGG - Intronic
961174507 3:124822752-124822774 CAGGCCCCACAGAAGGCACTGGG + Intronic
963262297 3:143205243-143205265 CAGGCATCATTCTTGGCACTGGG + Intergenic
963322196 3:143821059-143821081 CAGGCACCCTTGAGGGGACTGGG + Intronic
970994353 4:22248485-22248507 CAGGCTCCATTCTAGGCACTTGG - Intergenic
971395150 4:26220453-26220475 CAGGCATCATTGTAGGCACTTGG + Intronic
971893980 4:32565693-32565715 CAGTCTGCAAAGATGGCACTAGG - Intergenic
972106561 4:35495083-35495105 CAGCCTCCATGGCTGGCACTGGG - Intergenic
975221107 4:71813914-71813936 CAGCTTCCATGGCTGGCACTTGG + Intergenic
979604491 4:122623319-122623341 AAGGCTCCTGTGATTGCACTGGG - Intergenic
980483803 4:133426578-133426600 CAGGAGGCATTCATGGCACTGGG - Intergenic
982090302 4:151874816-151874838 CAGGCTCTGTTCAGGGCACTTGG + Intergenic
982464588 4:155714384-155714406 CAGGCATCATTGTAGGCACTGGG + Intronic
983642652 4:169957438-169957460 CAGGCACCATGGTTGGCAGTAGG + Intergenic
984222272 4:176992884-176992906 CATGTACCATTGATGGCATTTGG + Intergenic
987463691 5:18246964-18246986 CAGGCGGCATTCATGGGACTGGG - Intergenic
987999682 5:25331753-25331775 CAGCTTCCATGGCTGGCACTGGG - Intergenic
988346442 5:30042804-30042826 CAGCTTCCACTGCTGGCACTGGG - Intergenic
988828914 5:34968727-34968749 CAGTCTCCATGCATGCCACTGGG - Intergenic
989278892 5:39619615-39619637 CTGCCTCCACTGCTGGCACTGGG - Intergenic
992200800 5:74381817-74381839 CAGGCTCTTTTCATGGCATTAGG - Intergenic
1001590543 5:172861476-172861498 CAGGCTCCATTGATGGCACTGGG - Intronic
1003564511 6:7211793-7211815 CGGGCTCCAGTGATTGAACTTGG + Intronic
1004161259 6:13215185-13215207 CAGGCTCCGTGCTTGGCACTGGG + Intronic
1006035545 6:31208662-31208684 GAGGCTCCATTGCTGTGACTGGG - Intergenic
1006387910 6:33742183-33742205 CAGGCACCAATGCTGGGACTCGG + Intronic
1009276686 6:61690708-61690730 CAGGCTCCTTTTATAACACTGGG - Intronic
1013828208 6:114240897-114240919 CAGGTCCCAGGGATGGCACTTGG - Intronic
1015434822 6:133173318-133173340 CAGCTTCCATGGCTGGCACTGGG - Intergenic
1017889364 6:158626142-158626164 CATGCTCCATTGCTGCCATTGGG + Intronic
1019217700 6:170454284-170454306 CAGTCCCCACTGAGGGCACTCGG + Intergenic
1020557977 7:9693360-9693382 CAGGCATCATTCATGGCTCTTGG - Intergenic
1020742241 7:12036120-12036142 TTAGCTCCATTGATGCCACTTGG - Intergenic
1020859386 7:13471940-13471962 CAGGCTCCACTGGTGACATTTGG - Intergenic
1022628347 7:32061464-32061486 TAGGCTCCATTGAGGGGGCTTGG - Intronic
1023390839 7:39710236-39710258 CAGGCACCATTGATGGGGCTGGG + Intergenic
1028527310 7:91800704-91800726 CAGCTTCCATGGCTGGCACTGGG + Intronic
1029600154 7:101558623-101558645 CAGGCTCCATGGCAGGCACCAGG + Exonic
1029702787 7:102258660-102258682 CAGCCCCAATCGATGGCACTTGG + Intronic
1034740413 7:153468200-153468222 TAGGCTTCATTGATGGCAGAGGG + Intergenic
1035401115 7:158566455-158566477 CAGGCCCCATAGCGGGCACTTGG + Intronic
1040563055 8:48541504-48541526 CAGGGTACATGGATGGCACATGG - Intergenic
1041331418 8:56729530-56729552 CAGGCACCATTCTAGGCACTGGG - Intergenic
1041774443 8:61508940-61508962 CAGACTCCATTGAAAGCCCTGGG + Intronic
1043087071 8:75848793-75848815 CAGCTTCCATGGCTGGCACTGGG + Intergenic
1044774856 8:95677584-95677606 CAGTTTCCATGGCTGGCACTGGG + Intergenic
1046674560 8:117094010-117094032 CAGCTTCCATGGCTGGCACTGGG + Intronic
1048708710 8:137183909-137183931 CACGCTCCCTTGATGGCTCTTGG - Intergenic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1052013154 9:23434764-23434786 AAGGCTCCAGTGTTGGCTCTTGG - Intergenic
1055572688 9:77632666-77632688 CAGCTTCCACTGCTGGCACTGGG - Intronic
1056319627 9:85424141-85424163 CATGCTCTCTTGAAGGCACTGGG - Intergenic
1056986073 9:91364528-91364550 CAGGCACCATGAATGGCAGTGGG + Intergenic
1058643784 9:107111754-107111776 CAGTCTCCCTTGAGGTCACTAGG + Intergenic
1060572582 9:124656208-124656230 CTGCCTCCATTCATGGCACAAGG - Intronic
1061578649 9:131523404-131523426 GAGGCTCCACTGCTGGCCCTGGG - Exonic
1061937050 9:133863729-133863751 CAGGCTTCCTAGCTGGCACTGGG + Intronic
1062120156 9:134829815-134829837 CAGGCTGCACTGAAGGCGCTCGG + Intronic
1186705294 X:12134370-12134392 CAGGCACCACTGTAGGCACTGGG - Intergenic
1190016593 X:46832736-46832758 CAAGCTCCAGAGATGGCTCTGGG - Intergenic
1190360472 X:49644363-49644385 CAGCTTCCATGGCTGGCACTGGG + Intergenic
1190401859 X:50044909-50044931 CAGGCTCTATTGTAGGCACTGGG + Intronic
1190443157 X:50495795-50495817 CAAGCCACATTGTTGGCACTGGG - Intergenic
1192788310 X:74355172-74355194 CAGGCTCCAGTCATGTTACTGGG + Intergenic
1194871538 X:99138540-99138562 CAGGCTTCATTGATGGTAGCAGG + Intergenic
1198775765 X:140177491-140177513 CAGGCCACATAGATGGCAATTGG + Intergenic
1199366664 X:146994046-146994068 CAGGCACCATTCTTGGCACTGGG + Intergenic
1199595940 X:149505734-149505756 CAGGCGCTGTTGGTGGCACTGGG + Intronic
1199907549 X:152249273-152249295 GAGGTAACATTGATGGCACTTGG - Intronic
1200084314 X:153595902-153595924 CAAGCTCCATTGCTGGCACCTGG + Intronic
1200836066 Y:7732553-7732575 CAGGCTGCATTGGAGTCACTTGG - Intergenic