ID: 1001592749

View in Genome Browser
Species Human (GRCh38)
Location 5:172877654-172877676
Sequence GGAAAATGACACTGTCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001592749_1001592755 8 Left 1001592749 5:172877654-172877676 CCCCTGTGACAGTGTCATTTTCC 0: 1
1: 0
2: 0
3: 20
4: 236
Right 1001592755 5:172877685-172877707 TGTATCACCCTCTGCGTTATGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1001592749_1001592754 7 Left 1001592749 5:172877654-172877676 CCCCTGTGACAGTGTCATTTTCC 0: 1
1: 0
2: 0
3: 20
4: 236
Right 1001592754 5:172877684-172877706 CTGTATCACCCTCTGCGTTATGG 0: 1
1: 0
2: 0
3: 6
4: 75
1001592749_1001592758 30 Left 1001592749 5:172877654-172877676 CCCCTGTGACAGTGTCATTTTCC 0: 1
1: 0
2: 0
3: 20
4: 236
Right 1001592758 5:172877707-172877729 GTGATCTGTAGTGTCCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001592749 Original CRISPR GGAAAATGACACTGTCACAG GGG (reversed) Intronic
902657350 1:17878460-17878482 GGAATCTCACTCTGTCACAGAGG + Intergenic
905168123 1:36095207-36095229 TGAAACTGATACTGACACAGAGG - Intergenic
905609762 1:39340140-39340162 GCATAATGACACTCTCAGAGAGG + Intronic
906182593 1:43834880-43834902 GGAATCAGAAACTGTCACAGAGG - Intronic
906296262 1:44650826-44650848 GGAGACGGTCACTGTCACAGAGG - Exonic
907179794 1:52559533-52559555 GTAAAATGATACAGTCACTGTGG + Intergenic
907404346 1:54244704-54244726 GGAAAATGACACTTGGAGAGAGG - Intronic
913335008 1:117701560-117701582 GGAAAGAAACACTGTCAGAGTGG - Intergenic
914725643 1:150324938-150324960 GAAAAATGGCACTGTCAAAGAGG + Exonic
915708427 1:157869721-157869743 GGAAACTGACATTGTCAGTGAGG + Intronic
916550687 1:165847150-165847172 GACAAATCACACTGTCTCAGTGG + Intronic
916870638 1:168910997-168911019 GGAAATTGAAACCCTCACAGTGG - Intergenic
919977170 1:202620216-202620238 TGGGACTGACACTGTCACAGGGG - Intronic
920305118 1:205013797-205013819 GGAAAAGGAGACTGTAGCAGAGG - Intronic
920733305 1:208508935-208508957 GGAAAATGACATTTTTAAAGAGG + Intergenic
921234425 1:213110804-213110826 AGAAAATAACACAGCCACAGGGG - Intronic
921357194 1:214296071-214296093 AGAAAATGATACTGGCATAGAGG - Intronic
922872831 1:228917063-228917085 GGAAAGTGAGTCTGGCACAGTGG + Intergenic
923125767 1:231033230-231033252 GGAGAATGACACTGGCAACGGGG + Intronic
1064477635 10:15707795-15707817 GGAAACTCACTCTGTCACCGAGG - Intronic
1065069875 10:22012388-22012410 GGAGAATGAAGATGTCACAGTGG + Intergenic
1065177265 10:23090832-23090854 GGAAAATGACACGAATACAGGGG - Intergenic
1065498381 10:26353416-26353438 AAAAAATGACACTTTCAAAGAGG - Intergenic
1066066569 10:31765355-31765377 GGAAAATGACTTGGTCACATGGG - Intergenic
1068456494 10:57261333-57261355 GGCAGAGGGCACTGTCACAGTGG - Intergenic
1069636597 10:69929065-69929087 GGAAGATGAGAGGGTCACAGGGG - Intronic
1070212373 10:74338322-74338344 GGAAAATGACACAGCCACTCTGG + Intronic
1070641893 10:78176367-78176389 GGAGAATGTCACTGATACAGTGG + Intergenic
1070683809 10:78467369-78467391 GGAAAATGAAACCATCACAAAGG - Intergenic
1072733452 10:97863809-97863831 GGAAGATGACATTGGCACACAGG - Intronic
1073682821 10:105722923-105722945 GGGAAATGACTCTGTCAATGAGG - Intergenic
1073882490 10:107999562-107999584 TGAAAATGCCACTGCCACTGTGG + Intergenic
1074169230 10:110917111-110917133 TCAAAATGCCAATGTCACAGGGG + Intronic
1075003754 10:118816177-118816199 GGAGTCTCACACTGTCACAGGGG - Intergenic
1076551715 10:131282770-131282792 AGAAAATGAGACAGACACAGAGG + Intronic
1077605212 11:3605769-3605791 GGAACCTGGCACTGCCACAGTGG - Intergenic
1077605219 11:3605805-3605827 GGAACCTGGCACTGCCACAGTGG - Intergenic
1077605225 11:3605841-3605863 GGAACGTGGCACTGCCACAGTGG - Intergenic
1078470347 11:11581310-11581332 TGAAAATGAATCTGTCACATTGG - Intronic
1079303388 11:19299562-19299584 GAAAAATGACACAGAGACAGAGG - Intergenic
1080124410 11:28715190-28715212 GGAAATTGACAAACTCACAGTGG + Intergenic
1081025324 11:38005734-38005756 AGGAAATGACACTGTAAGAGAGG - Intergenic
1082160289 11:48882533-48882555 AGAAAATGACAATTTCACGGGGG + Intergenic
1082162077 11:48897873-48897895 AGAAAATGACAATTTCACGGGGG - Intergenic
1082609398 11:55280260-55280282 AGAAAATGACAACTTCACAGGGG + Intergenic
1086600453 11:88626993-88627015 AGAAAATAACATTGACACAGTGG - Intronic
1086916981 11:92541725-92541747 ATAAAATGACAGTTTCACAGAGG - Intronic
1087582834 11:100080697-100080719 TGTAAAAGACACTGTCACAGAGG - Intronic
1087598220 11:100281883-100281905 GAAAAATGCAACTGACACAGTGG - Intronic
1088637259 11:111834723-111834745 GGGAAAATACACTGTCATAGGGG - Intronic
1090467424 11:126947110-126947132 GGAAAAGGACACTGTGAGGGAGG - Intronic
1090985269 11:131760898-131760920 GGAAGACGTCACTGTCACAGGGG - Intronic
1092189559 12:6508735-6508757 GGAAAATAATAATGTTACAGTGG + Intronic
1095132330 12:38559082-38559104 GGAAAATGAATCTGTCAGAATGG + Intergenic
1095231451 12:39744882-39744904 AGTAAAAGACACTGTCAGAGTGG + Intronic
1097920141 12:65063270-65063292 AGAAACTGACACTGTGAGAGAGG - Intronic
1101440848 12:104703400-104703422 GGAAAAGGAGGATGTCACAGAGG - Intronic
1101557395 12:105823096-105823118 GGGAAATAAAACTGTCACTGTGG + Intergenic
1102930016 12:116855127-116855149 TGAAAATCAAACTGTCTCAGAGG - Intergenic
1108442005 13:50464002-50464024 GGAAAATGACATTTTCATGGTGG + Intronic
1110533938 13:76629196-76629218 GTAAAAAGACACAGTGACAGTGG - Intergenic
1110937359 13:81307621-81307643 AGAAAAAGACACTGACACCGAGG - Intergenic
1111431943 13:88156951-88156973 GGAAATTCACATTGTTACAGAGG + Intergenic
1112003254 13:95231509-95231531 GGAAACTGCCAGTGTCGCAGAGG + Intronic
1112133297 13:96547907-96547929 GAAAGATGAAGCTGTCACAGAGG + Intronic
1112304676 13:98262951-98262973 GGAAAGTGACACTGTAAAAGGGG - Intronic
1112351835 13:98641947-98641969 GGACAATGACAGTGAGACAGGGG - Intergenic
1115039003 14:28898155-28898177 GAAAAATGCCTTTGTCACAGAGG - Intergenic
1115844968 14:37519647-37519669 TGAAAAAGACACTGTTACAGGGG + Intronic
1117142097 14:52799486-52799508 AGAAAATAAAACTGTCAGAGTGG + Intergenic
1119679152 14:76578814-76578836 AGTTCATGACACTGTCACAGGGG + Intergenic
1120589411 14:86357525-86357547 GGAAAGTGACACTGTGGCGGAGG + Intergenic
1122456395 14:101855725-101855747 GGAAGATGTCACGCTCACAGTGG + Intronic
1202900496 14_GL000194v1_random:33826-33848 GGAAATTGTCAGTATCACAGTGG - Intergenic
1124101793 15:26702613-26702635 ATAAAATGATACTATCACAGTGG + Intronic
1124492833 15:30168600-30168622 TGGGACTGACACTGTCACAGGGG - Intergenic
1124750701 15:32369725-32369747 TGGGACTGACACTGTCACAGGGG + Intergenic
1126683983 15:51231343-51231365 TCAAAATGTCAATGTCACAGGGG + Intronic
1128577881 15:68788808-68788830 GGAAAAAGACAGGGCCACAGAGG - Intronic
1129599964 15:76993134-76993156 GGATAATGACAGTGTAACTGAGG + Intergenic
1130557396 15:84932285-84932307 GGTAAATGACACAGTGATAGGGG + Intronic
1130715340 15:86328633-86328655 TGAGATAGACACTGTCACAGGGG - Intronic
1130722039 15:86397589-86397611 GTGAAATGACAGTGTCACTGTGG - Intronic
1131888801 15:96949799-96949821 GTAAAATGAACCTGTCATAGGGG - Intergenic
1133015617 16:2938154-2938176 GGAAAGTGACACTGTGAGTGGGG - Intronic
1133113285 16:3562322-3562344 TTAAAAAGACACTGTCACACTGG - Intronic
1133975771 16:10599013-10599035 GGAAGATGACAGTTCCACAGAGG + Intergenic
1134537240 16:15035755-15035777 GAAAGATGACATTGTCACTGTGG + Intronic
1136412416 16:30085106-30085128 GGAAGATGGCAGAGTCACAGTGG - Exonic
1138101724 16:54257278-54257300 GGAAAATGGGACTCTCACAGTGG - Intronic
1138931706 16:61665906-61665928 GGAAAATGAAACTGTGATAAGGG - Intronic
1141368673 16:83467320-83467342 GGAAAAGAAATCTGTCACAGAGG - Intronic
1142551413 17:742435-742457 TGAAAAGGACAGTGTCACAGTGG - Exonic
1142765138 17:2060318-2060340 AAAAACTGACACTGACACAGGGG - Exonic
1142897386 17:2990660-2990682 GGAAAATGACGCAGCCACTGTGG - Intronic
1143646950 17:8236391-8236413 GGAAAAGGACTCTGGCAGAGTGG - Intronic
1144340545 17:14306235-14306257 GAAAAATGAAACTGACACGGTGG - Intronic
1145230684 17:21171363-21171385 GGAACATGCCACAGGCACAGCGG + Intronic
1149338684 17:55664231-55664253 GACAAATGAAACTGTTACAGAGG + Intergenic
1152058403 17:78050472-78050494 GAAAAATGACAATGGGACAGAGG + Exonic
1152405866 17:80097443-80097465 GGAACATGCCACTCACACAGAGG + Intronic
1152507019 17:80756156-80756178 GGTTAATGTCACTGTCACAGGGG + Intronic
1153513721 18:5884744-5884766 AGAAAATGACTTTGTCTCAGTGG - Exonic
1156166077 18:34422602-34422624 GGAAAATTACTCTGTCACCCAGG - Intergenic
1156648394 18:39195388-39195410 TGAACATGACATTGTCATAGAGG - Intergenic
1156865386 18:41883693-41883715 TGAAAATGACAATGTCATAGGGG + Intergenic
1156963311 18:43059235-43059257 CCAAAATGACACTGTGACATGGG + Intronic
1157086313 18:44583669-44583691 AAAAAATGACACTGGCACAATGG - Intergenic
1158405593 18:57156724-57156746 AGAAAATGGCACAGTGACAGAGG - Intergenic
1158507206 18:58057374-58057396 GGAAAATAAGACACTCACAGTGG + Intronic
1158842586 18:61404055-61404077 GGAAGAACACACTGTCAGAGTGG + Intronic
1161645566 19:5451396-5451418 GGAAACTGAGTCTGTGACAGGGG - Intergenic
1164926510 19:32134076-32134098 GTAAAATGGCACAGCCACAGTGG + Intergenic
1166974830 19:46599969-46599991 GAAAAATAAAACTGACACAGTGG - Intronic
1167016180 19:46842563-46842585 GGCAAATGAGAATGTTACAGAGG - Intronic
925367266 2:3319336-3319358 GGAAAAGGCCAATGGCACAGAGG + Intronic
926237490 2:11056497-11056519 GGAAAATGGCCCCCTCACAGTGG - Intergenic
926241450 2:11090313-11090335 GTAAAATGGCACAGTCACTGTGG + Intergenic
930310815 2:49737176-49737198 GGATAATGACATTGAGACAGAGG - Intergenic
930688744 2:54337109-54337131 GGAGGCTGACACTGGCACAGTGG - Intronic
931643586 2:64402156-64402178 GGAAAAAAAAACTGTCAAAGGGG - Intergenic
931916042 2:66957516-66957538 GGAAAATTACACATTTACAGTGG + Intergenic
932342445 2:70974831-70974853 GGAAGCTGACACTTTCACTGTGG - Intronic
935408974 2:102738906-102738928 GAAAAATGACAATGTCAGAGTGG + Intronic
940383817 2:153047103-153047125 GGAAAATGGCAAAGTCCCAGAGG - Intergenic
940419698 2:153465611-153465633 GGAAAATTAAACTGGCTCAGAGG - Intergenic
940971314 2:159899864-159899886 GGACAATGAAACTGCCACAGTGG - Intronic
941743960 2:169066535-169066557 AGAAAATGTGTCTGTCACAGAGG - Exonic
943402391 2:187430640-187430662 TGAAAATGAGACTCTCAGAGTGG + Intronic
947254235 2:228143919-228143941 GCAAAAAGACAAGGTCACAGAGG - Intronic
947476224 2:230449819-230449841 GGAAAATCACATAGACACAGAGG + Intronic
948851012 2:240705738-240705760 GGAAAAAGGCACTTTAACAGTGG + Intergenic
949081406 2:242103369-242103391 GGGGAATGAGACTGCCACAGTGG + Intergenic
1170475923 20:16714445-16714467 TGAAACTGACACTGTCCCAGAGG + Intergenic
1170905392 20:20511579-20511601 GGAAACAGACACAGTCACACAGG - Intronic
1171159690 20:22909955-22909977 GGAAAATGAGAATGCCACAAAGG + Intergenic
1172465214 20:35151502-35151524 TGATAATGACACTTTCTCAGAGG - Intergenic
1172593245 20:36132118-36132140 GGAAACTGACACAGTCACCTAGG - Intronic
1173624955 20:44465902-44465924 GGAGATGGCCACTGTCACAGGGG + Intergenic
1176619870 21:9048604-9048626 GGAAATTGTCAGTATCACAGTGG - Intergenic
1179149976 21:38801713-38801735 GGAAAATGACTGTGTCAGGGTGG + Intergenic
1183433035 22:37777268-37777290 GGGAAATGGCCCTGTCACCGCGG + Intergenic
949658661 3:6251826-6251848 GGAAAATGAAAATGTCAAGGAGG + Intergenic
950999363 3:17539927-17539949 GTAAAATGGTACAGTCACAGTGG - Intronic
954765870 3:52915701-52915723 GGAAAAAGAAATTGTCCCAGAGG - Intronic
956352448 3:68352704-68352726 GGCAGATGCCACTGCCACAGTGG + Intronic
956576132 3:70754745-70754767 TGAAAATGCCACTGGCACTGGGG - Intergenic
957898563 3:86455812-86455834 GTAAAATGACACAGTCACTCTGG + Intergenic
958048268 3:88312926-88312948 GGATAAAGTCACTGCCACAGTGG - Intergenic
960397365 3:117153726-117153748 AGAAAATGATACTGTCATATAGG + Intergenic
960527315 3:118724390-118724412 GGAGTCTCACACTGTCACAGGGG - Intergenic
960719022 3:120607126-120607148 GGAAAATGAGTCGGGCACAGTGG - Intergenic
962399678 3:135047717-135047739 GTAAAAAGAAACTGTCACAAGGG - Intronic
962963373 3:140331743-140331765 CCAAAATGAAAATGTCACAGGGG - Intronic
962971742 3:140407803-140407825 GCCTAATAACACTGTCACAGTGG + Intronic
963373320 3:144430228-144430250 TGAAAAAGACACTGACACTGGGG + Intergenic
965166707 3:165203327-165203349 GGAAAATGTGGCTGGCACAGTGG - Intergenic
968265186 3:197357220-197357242 GGAAACTCACAGGGTCACAGGGG - Intergenic
970546060 4:17131652-17131674 GGAAAAGGACAGGGTCACTGTGG - Intergenic
970913615 4:21307434-21307456 GGAAAATAACACTGGTTCAGAGG - Intronic
971462873 4:26921139-26921161 AGAAGATGACTCTGTGACAGTGG + Intronic
972315599 4:37922856-37922878 GGAAAAAGAATCTCTCACAGGGG + Intronic
973033510 4:45374617-45374639 TGAAAATGAAACAGTCTCAGAGG + Intergenic
975799817 4:78048772-78048794 GGAAGATGAAGCTGACACAGTGG + Intergenic
978218703 4:106242482-106242504 GCATAACGACAATGTCACAGTGG + Exonic
978643758 4:110903589-110903611 GGAAAAAGTCACTTTCTCAGGGG + Intergenic
982586847 4:157252499-157252521 GGAAAATGACAAGCTCACAATGG - Intronic
983454185 4:167941641-167941663 GGAAAGAGACACTGTCAAACTGG - Intergenic
983776636 4:171615863-171615885 GGAGAAGGACATTGCCACAGTGG + Intergenic
984496901 4:180509929-180509951 GAAAGATGACACAGTCACATTGG - Intergenic
984838297 4:184042851-184042873 GTAAAATGGCACAGTCACTGTGG - Intergenic
985295286 4:188431386-188431408 GGTAAATGAAACTGACCCAGTGG - Intergenic
986051873 5:4097766-4097788 TGAAAATGTCACTCTCCCAGGGG + Intergenic
987664861 5:20923899-20923921 GGAATAAGCCACTGACACAGTGG - Intergenic
989454294 5:41624510-41624532 AGAAAATGACAGTGTTAGAGAGG + Intergenic
989686720 5:44097338-44097360 GGAAAAAGGCAATGTCACAAAGG - Intergenic
990822330 5:59856517-59856539 GGGAAAATACACAGTCACAGTGG + Intronic
993928977 5:93913427-93913449 GGAAAGTGACAAGGTCATAGAGG - Intronic
993943024 5:94084450-94084472 GGAAATTGATATTGTCACACTGG - Intronic
994787513 5:104183000-104183022 GTAAAATGGTACTGTCACTGTGG - Intergenic
994805371 5:104440532-104440554 GGAAAGTGACCCCGTCACAACGG + Intergenic
997516389 5:134492753-134492775 GGAAAATGACACGGGCACACAGG - Intergenic
998301295 5:141023451-141023473 GTAAAATGATGCAGTCACAGTGG + Intergenic
999330328 5:150669669-150669691 GGAAAATCACTCTGTCACCCAGG + Intronic
999748415 5:154609118-154609140 GAAAAATGAGAGTGGCACAGTGG - Intergenic
1000371322 5:160539470-160539492 AGAAAATGAGACAGTCAGAGAGG - Intergenic
1000889419 5:166785357-166785379 CCCAAATGACACTTTCACAGTGG - Intergenic
1001408414 5:171493279-171493301 GGAGAATGACTATTTCACAGAGG - Intergenic
1001592749 5:172877654-172877676 GGAAAATGACACTGTCACAGGGG - Intronic
1001837556 5:174844886-174844908 GGAAGATCTCTCTGTCACAGTGG - Intergenic
1005233262 6:23729573-23729595 GCAAAATGACACAGCCACACTGG + Intergenic
1007624410 6:43235427-43235449 GGGAAATAAGCCTGTCACAGAGG - Intergenic
1007894707 6:45342107-45342129 GGAAAATGAGACTGCCACTTAGG + Intronic
1008657214 6:53628105-53628127 AGAAAAAGACTCTGTTACAGCGG - Intergenic
1010221845 6:73454699-73454721 GGCAAATGACTCTGTCTCAGGGG + Intergenic
1010633046 6:78222459-78222481 GGAAAATCACACTCCCACAGTGG + Intergenic
1012773833 6:103478889-103478911 AGAAAATATCACTATCACAGAGG + Intergenic
1013150397 6:107440282-107440304 GGAATATCACACTGGCACACAGG - Intronic
1013746989 6:113357473-113357495 GGAGAATGAGACTGAGACAGTGG + Intergenic
1016026756 6:139295151-139295173 TCAAAATGACACTTACACAGTGG + Intergenic
1017239592 6:152152234-152152256 GGGAAGTTACACTATCACAGAGG + Intronic
1019488122 7:1298830-1298852 AGTAAATGACACCGTCACAGGGG + Intergenic
1019896463 7:3987330-3987352 GCAAAATGAAACTGTCACCATGG + Intronic
1019927035 7:4200067-4200089 GGAGTATCACTCTGTCACAGAGG - Intronic
1022982455 7:35617377-35617399 GGATAAGGACACTGTGGCAGAGG - Intergenic
1023282522 7:38585686-38585708 GGAAAATTCCACTGGCACGGTGG - Intronic
1023507039 7:40910611-40910633 CCAAAATAACACTGTCAGAGCGG - Intergenic
1024138198 7:46432051-46432073 GGAAAATGACAGCGTGGCAGAGG - Intergenic
1024831011 7:53457365-53457387 GGAAAATGGCACAGTCACTTTGG + Intergenic
1026149240 7:67774033-67774055 GGAAACTGACATTCTCAGAGGGG + Intergenic
1028131796 7:87184228-87184250 GTAAAATGAAACTGTCTTAGTGG + Intronic
1028742592 7:94292825-94292847 GGAAAAAGACCTTGTCACTGAGG - Intergenic
1029374452 7:100169515-100169537 AGAAAATGAGCCAGTCACAGAGG + Intergenic
1030171360 7:106606152-106606174 GGAAAATGAGACAGTGGCAGGGG - Intergenic
1030535957 7:110767476-110767498 GGTAAAGGACACTGTTATAGTGG - Intronic
1030660640 7:112215375-112215397 ACAACATGACACTGTCCCAGAGG - Intronic
1031956193 7:127944914-127944936 GGAAGATGGCACTGTAACACTGG - Intronic
1031973986 7:128082463-128082485 GTGAAATGACACTGCCACAAAGG - Intronic
1032560455 7:132885491-132885513 AAAAAATGACATTGTTACAGAGG + Intronic
1033166987 7:139048118-139048140 ACCAAATGACAATGTCACAGTGG + Intronic
1033480958 7:141739819-141739841 GGAAAATGACAGAGTCATGGAGG - Intronic
1033762622 7:144452160-144452182 CGAAAATGCCACAGTCACATGGG + Exonic
1034921684 7:155088376-155088398 GGAAAAGGACACTGTTCCAAAGG - Intergenic
1035539317 8:420167-420189 GGGGAATGAGACTGCCACAGTGG + Intronic
1036784920 8:11679737-11679759 GGAAAGTGACATTTTTACAGGGG + Intronic
1037494480 8:19425407-19425429 CGAAAATGAGACTGTGACACGGG - Intronic
1037908202 8:22727829-22727851 GGAAACTGAGGCTGTCCCAGTGG - Intronic
1038198005 8:25385540-25385562 GGAAAAGGCCAGAGTCACAGAGG + Intronic
1038741007 8:30216824-30216846 AGAAAATGCCACAGTCACAAAGG + Intergenic
1042431002 8:68706394-68706416 GGAGAGTGACACTGTGAAAGAGG + Intronic
1043290237 8:78590123-78590145 GGAAACTGACAAGTTCACAGGGG - Intronic
1044240246 8:89880049-89880071 GGAAAATGATACTGACACTTTGG + Intergenic
1044574984 8:93758543-93758565 GGAAAATGTCACTGTCCCATTGG + Exonic
1045568745 8:103348493-103348515 GGAAAATGTCACTGACACACTGG - Intergenic
1045930578 8:107620892-107620914 TGAACATGACAGTCTCACAGAGG + Intergenic
1047038082 8:120961746-120961768 GGAGAGTGAGACTGTGACAGTGG + Intergenic
1047643092 8:126841815-126841837 GGAAAATGACACAGCAGCAGGGG - Intergenic
1049684909 8:143935436-143935458 TGAAAAATACACTGTCACATGGG + Intronic
1055001072 9:71448969-71448991 GGAAAATGACCCTGCCATAAAGG + Intergenic
1056946796 9:91004602-91004624 GAATAATGACACTGGCATAGTGG - Intergenic
1057127722 9:92632298-92632320 GGAAAATGACACAGTCACTCCGG - Intronic
1057857592 9:98613422-98613444 GGAGCAAGACACTGTCTCAGGGG + Intronic
1061527444 9:131178489-131178511 GGAAAACCAGACTGTGACAGTGG - Intronic
1203567040 Un_KI270744v1:100455-100477 GGAAATTGTCAATATCACAGTGG + Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1188867799 X:35335502-35335524 GGAAAATGACACTGCTACATTGG - Intergenic
1189055582 X:37696364-37696386 GTAAAATGTCAGTGTCACAAGGG + Intronic
1191720614 X:64225548-64225570 GGAGGAGGACACTGACACAGAGG - Exonic
1191901834 X:66049096-66049118 GGAAAAAGACACTTTCATACAGG + Intergenic
1191962299 X:66717037-66717059 GCAAAATGACACAGCCACTGTGG + Intergenic
1193861165 X:86669915-86669937 GGTATGTAACACTGTCACAGGGG + Intronic
1194098231 X:89670438-89670460 GGAAAATGAGACTGATACATAGG - Intergenic
1196303219 X:114069915-114069937 GGAAAATGAGACTTTAAGAGAGG - Intergenic
1198003204 X:132462082-132462104 GATAAATGACACAGTCACAAAGG + Intronic
1198501000 X:137246411-137246433 GGAAAGTGACATTATCAAAGTGG - Intergenic
1200451247 Y:3331826-3331848 GGAAAATGAGACTGATACATAGG - Intergenic
1201275110 Y:12289455-12289477 AGAAAAAGACAGTGACACAGAGG + Intergenic