ID: 1001592995

View in Genome Browser
Species Human (GRCh38)
Location 5:172879125-172879147
Sequence CTGTTCTTGCAGACGAATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001592995_1001593002 26 Left 1001592995 5:172879125-172879147 CCGAGATTCGTCTGCAAGAACAG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1001593002 5:172879174-172879196 AAGTTAAAATAGCAAAGCTGAGG 0: 1
1: 1
2: 10
3: 55
4: 608
1001592995_1001592999 -10 Left 1001592995 5:172879125-172879147 CCGAGATTCGTCTGCAAGAACAG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1001592999 5:172879138-172879160 GCAAGAACAGGGGAGAACTAAGG 0: 1
1: 0
2: 2
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001592995 Original CRISPR CTGTTCTTGCAGACGAATCT CGG (reversed) Intronic
900922534 1:5682586-5682608 CTGTACTTGCAGACGCAACCTGG - Intergenic
905052380 1:35062810-35062832 CTGTTCTTACTGACAGATCTTGG - Intronic
910152969 1:84175764-84175786 ATGTTCCTGCAAACAAATCTTGG + Intronic
911967923 1:104390675-104390697 CTGTTCTTGCAGACTCATAGAGG - Intergenic
921065234 1:211617833-211617855 CTGTTCTTTCAGATGACTTTGGG + Intergenic
923766599 1:236897964-236897986 CTGTTTTTACAGTGGAATCTAGG + Exonic
1062886527 10:1020788-1020810 CTCTGCTTGCAGACGCCTCTGGG + Exonic
1063395531 10:5684444-5684466 CTGTTCTTGCAGCAGCACCTGGG + Intergenic
1064678244 10:17783203-17783225 GTGTTCTTGCTGAGGAGTCTGGG - Intronic
1067004959 10:42651859-42651881 CTGATCTTGCAGAGGAACCAAGG + Intergenic
1070071500 10:73094767-73094789 GGGTTGTTGCAGATGAATCTTGG - Intronic
1074734824 10:116419188-116419210 CTGTTTTTGCACATGAAACTAGG + Intergenic
1080523629 11:33090717-33090739 CTTTTCTTGCAGAGAAATCTGGG - Exonic
1081748983 11:45494319-45494341 CTGTTCTTGGAGCTTAATCTTGG - Intergenic
1085528816 11:77179723-77179745 CTGTCCTTGCAGATGCGTCTGGG + Exonic
1088763112 11:112950571-112950593 CAGTTCTTGCAGAGGTATCAAGG + Intergenic
1091628125 12:2138347-2138369 CTGTGCTTGCAGATGGATCCTGG + Intronic
1092628551 12:10354532-10354554 CTGTTAGTTCTGACGAATCTGGG - Intergenic
1095234620 12:39781878-39781900 CTGTACTTGCAGAGGTGTCTAGG + Intronic
1095875527 12:47076667-47076689 CTGTTCTAGCAAACTAATATTGG - Exonic
1101572515 12:105966921-105966943 CTGTTGTTGCAGAAGAATGTAGG + Intergenic
1113043893 13:106133425-106133447 CTGCTCCTGCAGAGGAATATTGG - Intergenic
1114833563 14:26175842-26175864 CTGGTCATGCAGGCGGATCTTGG - Intergenic
1120513081 14:85438844-85438866 CTTTTCTTGGAGACAAATGTAGG + Intergenic
1125246783 15:37649974-37649996 CACTTCTTGCAGATGTATCTAGG + Intergenic
1128121170 15:65147834-65147856 TTGTTCTTCCAGACTTATCTAGG + Intergenic
1138960438 16:62022803-62022825 CTGTACTTGCAGTACAATCTGGG - Intronic
1142562118 17:816407-816429 GTTTTCTTGCAGAAGGATCTTGG - Intronic
1156609635 18:38711364-38711386 CTGTTCTTGCCAACTAATATGGG + Intergenic
1157840630 18:50955116-50955138 CTGCTCTTGCTGAGGTATCTAGG - Intergenic
1160381156 18:78457151-78457173 CTGCTCTTGCCTCCGAATCTAGG + Intergenic
1164593069 19:29516777-29516799 CTGTTCTCTCAGAGGAACCTTGG - Intergenic
1165205226 19:34178684-34178706 TTGTTCTTGTAGAAGTATCTTGG + Intronic
1166509602 19:43395982-43396004 CTGTTCTTGCTGCCTCATCTTGG - Intergenic
925637062 2:5950869-5950891 CAGTTCTTCCAGAGGAATCCAGG - Intergenic
928717109 2:34073865-34073887 CTATTCAGCCAGACGAATCTTGG - Intergenic
931430952 2:62208662-62208684 CTGTTCTAGCAAACCATTCTTGG - Intronic
935966632 2:108483651-108483673 CAGTCCTTTCAGAAGAATCTAGG + Intronic
944426360 2:199587466-199587488 CTGCTTTTGCAGTCTAATCTTGG - Intergenic
945838454 2:214859925-214859947 CTGTTCTTGTAGAGGACTATGGG + Intergenic
946179914 2:217942907-217942929 CTGTTCTAGAAGAGGAAACTGGG - Intronic
1168922333 20:1550596-1550618 CTGTACCTGCAGAGGATTCTGGG - Intronic
1175891934 20:62319588-62319610 CTGTTCTTCCAGGCCAAGCTCGG + Intronic
1177218024 21:18154355-18154377 CTGTTCATGCAAACTAATCCTGG - Intronic
1178971036 21:37177100-37177122 CTGTTCTTGCCTACATATCTGGG + Intronic
1185249150 22:49790563-49790585 TTGTTCTTGCAGACTTAACTAGG - Intronic
957296490 3:78339807-78339829 CTGTGCTGGCAGCCTAATCTTGG + Intergenic
960127251 3:114013886-114013908 CTGTTTTTGAGGATGAATCTGGG - Intronic
961229616 3:125292076-125292098 CTGTTCTTGCAGTTCTATCTTGG - Intronic
962430187 3:135311906-135311928 CTGTTGTTGCAGCAGAATTTTGG - Intergenic
972420038 4:38878395-38878417 CTGTTCTTGCAGGGGTATTTCGG - Exonic
974074399 4:57155556-57155578 CTGTTTTTGCAGACTCCTCTTGG + Intergenic
976353992 4:84093836-84093858 CTGTTCTTTCAGAGGCAGCTGGG - Intergenic
976378384 4:84371443-84371465 CTGTTGTGGAAGATGAATCTGGG - Intergenic
976434103 4:84997162-84997184 CTGTTTTTGCAGCCAAGTCTTGG - Intergenic
977644431 4:99396065-99396087 TTGTTCTTGCAGACTCACCTTGG - Intergenic
979855481 4:125627107-125627129 CTGATCTGGCAGCCTAATCTGGG - Intergenic
983043478 4:162957584-162957606 CTTTTCTTGAAGTAGAATCTGGG - Intergenic
992753259 5:79880544-79880566 CTGTAGTTGCAAAGGAATCTGGG - Intergenic
993563511 5:89443092-89443114 CTTTTCTAGCTGACCAATCTTGG - Intergenic
994506265 5:100646419-100646441 CTGTTCTGAAAGACGAATCTGGG + Intergenic
1000745553 5:165028208-165028230 ATGTCATTGCACACGAATCTAGG - Intergenic
1001592995 5:172879125-172879147 CTGTTCTTGCAGACGAATCTCGG - Intronic
1003499540 6:6693292-6693314 CTGTTCTAGTTGAAGAATCTGGG + Intergenic
1005051208 6:21685606-21685628 CTGTTCTTACAGAATAATCTTGG + Intergenic
1006592299 6:35167291-35167313 CGTTTCATGCAGACAAATCTTGG - Intergenic
1008762215 6:54865271-54865293 CTGTTCTTGTAGGCAATTCTTGG + Intronic
1010547822 6:77180354-77180376 CTGTTCATGCAGCCGTGTCTTGG - Intergenic
1016670629 6:146702151-146702173 CTGTTCTAGGATATGAATCTAGG + Intronic
1018462668 6:164013781-164013803 CTGTTCTTGGAAATGTATCTTGG + Intergenic
1020613446 7:10429125-10429147 CTGTTCTAGAAAACGAATCTTGG + Intergenic
1027396277 7:77757913-77757935 CTATTTTTCCACACGAATCTGGG - Intronic
1037163773 8:15802002-15802024 CTGTTCTTCGAGAAGAATCTTGG + Intergenic
1038539491 8:28380380-28380402 CTGGTTTTGCAGACAAATCAAGG - Intronic
1039510085 8:38084909-38084931 CTGATCTTGCAGAGGAACCAAGG - Intergenic
1054754436 9:68943127-68943149 CTGATATTGCAAAAGAATCTGGG - Intronic
1056293123 9:85164016-85164038 ATGTTCTTGCAGAGGCTTCTTGG + Intergenic
1186870209 X:13764169-13764191 CAGTTTTTGCAGAAGAGTCTTGG - Intronic
1198045461 X:132897319-132897341 CTGTTCTTCCAAATCAATCTCGG - Intronic