ID: 1001593030

View in Genome Browser
Species Human (GRCh38)
Location 5:172879398-172879420
Sequence TTCCATGAGAATGTACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001593030_1001593032 -6 Left 1001593030 5:172879398-172879420 CCTTCCTGTACATTCTCATGGAA 0: 1
1: 0
2: 1
3: 8
4: 206
Right 1001593032 5:172879415-172879437 ATGGAATTTGCTGTATCCTAAGG No data
1001593030_1001593035 16 Left 1001593030 5:172879398-172879420 CCTTCCTGTACATTCTCATGGAA 0: 1
1: 0
2: 1
3: 8
4: 206
Right 1001593035 5:172879437-172879459 GCGTGAGGAAGCTAGAGACGTGG 0: 1
1: 0
2: 0
3: 12
4: 119
1001593030_1001593033 1 Left 1001593030 5:172879398-172879420 CCTTCCTGTACATTCTCATGGAA 0: 1
1: 0
2: 1
3: 8
4: 206
Right 1001593033 5:172879422-172879444 TTGCTGTATCCTAAGGCGTGAGG No data
1001593030_1001593036 22 Left 1001593030 5:172879398-172879420 CCTTCCTGTACATTCTCATGGAA 0: 1
1: 0
2: 1
3: 8
4: 206
Right 1001593036 5:172879443-172879465 GGAAGCTAGAGACGTGGATTTGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001593030 Original CRISPR TTCCATGAGAATGTACAGGA AGG (reversed) Intronic
900876642 1:5347681-5347703 TTCCATGAGAGGTCACAGGAAGG + Intergenic
901505856 1:9685250-9685272 TTCTATTAGAATAAACAGGAGGG - Intronic
902095416 1:13940167-13940189 TTCCAAAAGAATGAAGAGGAGGG - Intergenic
904145092 1:28384197-28384219 TTCCAAAAGAATGAAGAGGAGGG - Intronic
904981877 1:34510749-34510771 TTCCATGATACAGTATAGGAAGG + Intergenic
906857346 1:49322325-49322347 ATACATGAAAATGGACAGGAAGG + Intronic
907644580 1:56229428-56229450 TCCCTTGATAATGTACAGAAAGG + Intergenic
907674106 1:56502954-56502976 ATCCATGAGATTGTTCAGTATGG - Intronic
908200930 1:61794523-61794545 TCCCATGGGAAGGGACAGGAAGG - Intronic
909200037 1:72679781-72679803 TTCCATGAGAAAGAAAGGGAAGG + Intergenic
909880654 1:80873296-80873318 TTCAATGAAAATTTACAGGCTGG - Intergenic
910282639 1:85518355-85518377 TTCTCTTAGACTGTACAGGAAGG - Intronic
910689581 1:89952297-89952319 TTCCTTGAGAATCTCCAGTAAGG + Intergenic
910736463 1:90463586-90463608 ATCCTTGAGATTGAACAGGAAGG + Intergenic
911579072 1:99614494-99614516 TTCCATGAGAATTTACTGTCAGG + Intergenic
912071631 1:105817654-105817676 TTCCTTTAGAAAGTCCAGGAAGG + Intergenic
912333844 1:108844547-108844569 ATCCATGAAAATGGAGAGGAAGG + Intronic
912466461 1:109878029-109878051 TGCCATGAGAATGTATAATAGGG - Intergenic
912782408 1:112564046-112564068 TTCTATGAGATTGGACAGGCAGG + Intronic
913990630 1:143608438-143608460 TTACAGGAGAAGTTACAGGAAGG - Intergenic
914207375 1:145544628-145544650 TTCTCTTAGACTGTACAGGAAGG + Intergenic
914817473 1:151073620-151073642 TTGCTTGAGAAAGTAAAGGAAGG + Intronic
915167168 1:153954504-153954526 ATCCAGGAGAATGTTCAGGCAGG + Intronic
916639032 1:166707013-166707035 TTCCATGCTCATGGACAGGAAGG - Intergenic
920503056 1:206497541-206497563 TCCCATGAAGATGGACAGGAAGG - Intronic
924015512 1:239716822-239716844 CAAAATGAGAATGTACAGGAGGG + Intronic
924719591 1:246609607-246609629 TGCCATGAAAATGGAAAGGAGGG - Intronic
1063221146 10:3969180-3969202 TTACATCAAAATGTAAAGGAAGG - Intergenic
1063259729 10:4373360-4373382 ATCCATGGGAAGATACAGGAGGG - Intergenic
1064466725 10:15590307-15590329 TTCAATGATGATCTACAGGATGG + Intronic
1065317442 10:24477186-24477208 TTCCTGGGGAATGTATAGGAAGG + Intronic
1066321633 10:34308702-34308724 TTCCAAGAAAATGTCCAGGCAGG + Intronic
1070287578 10:75094956-75094978 TTCCAGGATACTGTAGAGGATGG - Intronic
1070491277 10:76979183-76979205 TTGCATGAGATTGTTAAGGAAGG + Intronic
1070491658 10:76982251-76982273 TTGCATGAGAATGTCAAGGGAGG + Intronic
1070551794 10:77495892-77495914 TTCCATGAGCAACTACAGGGAGG - Intronic
1071105849 10:82093780-82093802 TTCCATGACAGTGTCCAGGTGGG + Intronic
1072233881 10:93436893-93436915 TTCCATGAAAATATAGAGCAAGG - Intronic
1074488634 10:113916139-113916161 TTCTTTGAGCATGTACAGGGTGG + Exonic
1074957575 10:118407459-118407481 TTCCTAAAGAATGTACAGTAAGG - Intergenic
1075351998 10:121732557-121732579 ATCCTTGAAAATGTTCAGGAGGG - Intergenic
1076089728 10:127672484-127672506 TTCTATGAGAAAATACAAGAGGG + Intergenic
1076169982 10:128311223-128311245 TTTCATGTGAAAATACAGGAAGG + Intergenic
1077687162 11:4304771-4304793 TTCAATAAGAATGTATAGGTTGG + Intergenic
1078126550 11:8570684-8570706 TTACCTGAGAATGCAGAGGAGGG + Intronic
1081082904 11:38765772-38765794 TTCTATGATAAGTTACAGGAAGG - Intergenic
1081657504 11:44867234-44867256 TTCCATCAGAATCTCCTGGAGGG - Intronic
1081904328 11:46657673-46657695 TTCCATGTGCTTGTGCAGGATGG - Intronic
1083883992 11:65562057-65562079 TTACAGGAGAATGTACATCATGG - Intergenic
1086574702 11:88326217-88326239 TTCCAAGGGAGTGTTCAGGAGGG + Intronic
1089535454 11:119158307-119158329 GTCCCTGAGGATGGACAGGAAGG - Exonic
1097359389 12:58641726-58641748 TTCCATGAGGCTAAACAGGAAGG - Intronic
1097525190 12:60725203-60725225 TTTCATGAGAATGGCCAGGTTGG - Intergenic
1097736312 12:63185261-63185283 TTCTATGATAATGGAGAGGAAGG - Intergenic
1099068718 12:78017996-78018018 TTCCATGTGAATATAAAGCAAGG + Intronic
1101652941 12:106694274-106694296 TTCCCTGTGGAAGTACAGGATGG - Intronic
1102262990 12:111456371-111456393 GTACAGGAGAATGTACAGGGTGG + Intronic
1103257406 12:119553901-119553923 TTCCATATGAATGCACAGGAGGG + Intergenic
1104008997 12:124915493-124915515 GGCCCTCAGAATGTACAGGAAGG - Intronic
1106592449 13:31109518-31109540 TGCCATGGGCATGCACAGGAGGG - Intergenic
1107109639 13:36682814-36682836 TTTCTTAACAATGTACAGGAAGG - Intronic
1108095493 13:46896570-46896592 TTCAATGAGAATTTCCAGGGAGG - Intronic
1114631851 14:24164330-24164352 TTCCAGGAGAGTGTATAGGGTGG - Intronic
1115310282 14:31972717-31972739 TGCCATGTGAAGGTACAGCAAGG - Intergenic
1115463425 14:33686916-33686938 TTTTATAAAAATGTACAGGATGG + Intronic
1116362076 14:44012490-44012512 TTCCATGAAAAGATTCAGGAAGG - Intergenic
1116896331 14:50318788-50318810 TACCATGAGAATCTAGAGAAGGG - Intronic
1119460183 14:74795601-74795623 TGATATGAGAATGTAGAGGAGGG - Intronic
1120278833 14:82413192-82413214 TTCCATGAAGATAGACAGGATGG + Intergenic
1121806430 14:96828935-96828957 TTCCATTAGAAGCCACAGGAGGG + Intronic
1122832861 14:104410327-104410349 TTCCCTGTGAATGTTCACGAAGG - Intergenic
1126003078 15:44230239-44230261 TTACATGACAATGGAAAGGAGGG + Intergenic
1126368628 15:47922264-47922286 TTCCATTACAGTGTCCAGGATGG - Intergenic
1127484446 15:59406146-59406168 TTCAATGAGAATGATCTGGAAGG - Intronic
1134811991 16:17175617-17175639 TTCCATGAGAGAGGACAGGGAGG - Intronic
1134812252 16:17177708-17177730 TTCCAAGATAAATTACAGGAGGG + Intronic
1137533372 16:49298610-49298632 GTCCATGAGATTGAAAAGGAAGG - Intergenic
1143006881 17:3842534-3842556 TTCCAAGAAAATGTCCAAGACGG - Intronic
1146227584 17:31080132-31080154 TCCCGTTATAATGTACAGGAGGG + Intergenic
1146357204 17:32144072-32144094 TTCCTTGACAAGGTTCAGGAAGG + Intronic
1151381793 17:73730786-73730808 TTCTATGGGAATGCACAGGATGG - Intergenic
1153325054 18:3810164-3810186 TTCCAAGAGTAGCTACAGGAGGG + Intronic
1154312553 18:13278612-13278634 ATACATGAGAATTTTCAGGAAGG + Intronic
1155545762 18:26913011-26913033 CCACATGAGAATGCACAGGAGGG + Exonic
1156223509 18:35078759-35078781 TTCAAGTAGAATGTAAAGGATGG - Intronic
1157417929 18:47521447-47521469 TTCCTTGGGAACTTACAGGAGGG + Intergenic
1158242633 18:55394192-55394214 TACCATGATAATGAACAGCAGGG - Intronic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1158860846 18:61590965-61590987 TTCTATAAGAATCTACATGACGG + Intergenic
1159662394 18:71114789-71114811 TTTCCTGAGAACATACAGGAGGG - Intergenic
1162131496 19:8528853-8528875 CTCTATGAGTTTGTACAGGAAGG + Intronic
1168232842 19:55044376-55044398 TACCATGAGAATTGATAGGAAGG + Exonic
925392935 2:3510886-3510908 TTCCAAGAAACTGAACAGGAGGG + Intronic
929443991 2:41988666-41988688 CTCCATGAGAATGTACATTGAGG + Intergenic
930536886 2:52654548-52654570 TTGCATGGGAATGGATAGGAAGG - Intergenic
931265275 2:60654815-60654837 TTCAATGAGAATGTCCAGACCGG + Intergenic
931704999 2:64939859-64939881 ATCCCTGAGAATGTGCTGGAGGG - Intergenic
937710691 2:124977228-124977250 TCACATGAGAATGTTGAGGATGG - Intergenic
939912792 2:148004133-148004155 TTCCATGCGCATGGATAGGAAGG + Intronic
940997896 2:160170207-160170229 TTCCATATGAGTGTACAGGAGGG - Intronic
941546972 2:166862978-166863000 TGCCAAGAGAATGTACAGCACGG + Intergenic
942580940 2:177415612-177415634 TTGCATGATAATGTTCAAGAAGG + Intronic
944326421 2:198410349-198410371 TTAGCTGAGAATGTACAGTAGGG + Intronic
1169646602 20:7817518-7817540 TGTCATGAGAGTTTACAGGAAGG + Intergenic
1170229422 20:14028415-14028437 TTCCAGGGGAATGAACAGTACGG + Intronic
1172625868 20:36346413-36346435 TTCCAGGAGAGTGTCCCGGATGG - Intronic
1174926974 20:54770940-54770962 TGCCCTGAGAACGTTCAGGAAGG - Intergenic
1175572393 20:60033952-60033974 TTCTATGAGAATTTATAGAAGGG - Intronic
1175646000 20:60672196-60672218 TTCCATGAGATTGTACAAACAGG + Intergenic
1175744002 20:61441211-61441233 TTCCAAGAGAATGGACAGTTTGG - Intronic
1176006736 20:62868835-62868857 TTCCAAGAAACTGAACAGGAGGG + Intergenic
1176128617 20:63486994-63487016 TTCCCTGAGGATGCAGAGGAGGG - Intergenic
1176128630 20:63487037-63487059 TTCCCTGAGGATGCAGAGGAGGG - Intergenic
1176128644 20:63487080-63487102 TTCCCTGAGGATGCAGAGGAGGG - Intergenic
1176128657 20:63487123-63487145 TTCCCTGAGGATGCAGAGGAGGG - Intergenic
1176128685 20:63487210-63487232 TTCCTTGAGGATGCAGAGGAGGG - Intergenic
1176128698 20:63487254-63487276 TTCCCTGAGGATGCAGAGGAGGG - Intergenic
1178229211 21:30761790-30761812 TTCCATGGGAATATAGATGATGG - Intergenic
1179236147 21:39548157-39548179 TTCCAGGAGAGTGGACAGCAGGG - Intergenic
1179262324 21:39768784-39768806 TTCCAAGGGAATATTCAGGAAGG + Intronic
1179396464 21:41044798-41044820 TACCATGAGACTCTACAGAAAGG + Intergenic
1180149519 21:45940571-45940593 TTCCATGAGAATGAAAAAGGAGG - Intronic
1184880537 22:47301689-47301711 TTGCATGAAAATGTACTAGAAGG - Intergenic
1185026545 22:48417426-48417448 TTCCATCAGAAGCCACAGGAGGG - Intergenic
951047684 3:18059276-18059298 TTCCAGGGGACTGTATAGGAAGG - Intronic
952604256 3:35125167-35125189 TTCCATGGGGATGGAGAGGAAGG - Intergenic
952824132 3:37510695-37510717 TTCCCTGAGAAGGGACAGAAAGG + Intronic
953098442 3:39802253-39802275 TTACACGAAAATGTACAGGAAGG + Intergenic
953396084 3:42571466-42571488 GTGTATGTGAATGTACAGGATGG + Intronic
960236265 3:115286039-115286061 TTCAAAGAGAATGAACATGAGGG - Intergenic
961002164 3:123381302-123381324 TTCCAGGAGAATGGAGATGAAGG - Intronic
961436516 3:126922517-126922539 ATCTCTCAGAATGTACAGGATGG + Intronic
964887333 3:161499582-161499604 TAACATGAGCATGTACAGGAAGG - Intronic
967516579 3:190376506-190376528 TTCCATAGGAATATACAGCAAGG + Intronic
969147697 4:5138730-5138752 TGCCATGAGAATGTATCGTAGGG + Intronic
970443767 4:16107406-16107428 CACCATGAGACTGTAGAGGAGGG - Intergenic
974220275 4:58960408-58960430 TTTCATAAGAATATACAGAATGG + Intergenic
975115768 4:70678968-70678990 TTTTATGAGGATGAACAGGAAGG - Intronic
978400612 4:108326470-108326492 TCCCATGAGTATGGAAAGGAGGG - Intergenic
978669376 4:111227975-111227997 TTGCATGAGAAGGTTCAAGATGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
984530436 4:180909500-180909522 TTCCATGGGAAGGAAGAGGAAGG - Intergenic
986569450 5:9149969-9149991 CTCCATGAGGAGGCACAGGATGG - Intronic
986598735 5:9450016-9450038 TTTTATGAGCATGAACAGGATGG - Intronic
987824061 5:23005515-23005537 TGCTACGAGAATGTACAGGGGGG - Intergenic
988502872 5:31798320-31798342 TTCCCTCTGAATCTACAGGATGG + Intronic
989478653 5:41903385-41903407 TTCCATGAGAAACAATAGGATGG + Intergenic
990086943 5:51990263-51990285 CTCAATGAGAATGTAAAGAAAGG - Intergenic
990846793 5:60149736-60149758 TGCTATGAGAATGCATAGGAAGG - Intronic
992931092 5:81646395-81646417 TTCCATGGGAATGTAAAATAGGG - Intronic
994176812 5:96719964-96719986 TTCCATGAGAATGTAGATGAGGG - Intronic
995159116 5:108954878-108954900 GTCCATCAGAATATACAGAAAGG - Exonic
997302898 5:132819486-132819508 TTACATGTGAATGCACAGCACGG + Intergenic
998783690 5:145686007-145686029 TTACATGGGAATGAACAGCATGG + Intronic
999998796 5:157118094-157118116 ATCTATGAGAATGTGCAGAATGG - Intronic
1000899389 5:166894552-166894574 TTGCATGATAGTCTACAGGATGG - Intergenic
1001105845 5:168853922-168853944 TTGCCTGAGTTTGTACAGGAAGG - Intronic
1001593030 5:172879398-172879420 TTCCATGAGAATGTACAGGAAGG - Intronic
1004984808 6:21069674-21069696 TTCCAGAAAAATGTAGAGGAAGG - Intronic
1005388542 6:25310260-25310282 TACCATGAGAACATAAAGGAGGG + Intronic
1007347688 6:41245434-41245456 TTCCATGCTCATGGACAGGAAGG + Intergenic
1008184976 6:48377586-48377608 TCCCATGAGAATCCCCAGGATGG + Intergenic
1009727779 6:67557703-67557725 TTCCAGAAGAAGGAACAGGAAGG - Intergenic
1010275584 6:73965192-73965214 TTGCATGAGAAGAAACAGGATGG + Intergenic
1011091037 6:83600153-83600175 TTCCATAGGAATGGACAGCAAGG + Intronic
1015373959 6:132489458-132489480 TTCCTGGAGAATGTGAAGGATGG + Intronic
1015626854 6:135188380-135188402 AGCCATGAGAATGAAAAGGACGG - Intronic
1015809043 6:137142914-137142936 TTCCACTAGAATGTAAAGGCAGG - Intergenic
1015934845 6:138398513-138398535 TTCCATGAGACGGTACAGCCTGG - Intergenic
1018577705 6:165276753-165276775 TTCCATGAGGATGAGGAGGAAGG - Intergenic
1021725586 7:23545119-23545141 TACAAGGACAATGTACAGGATGG + Intergenic
1022057567 7:26755074-26755096 TTCAGTGAGAATGTACATCATGG - Intronic
1023732039 7:43201341-43201363 GTCCATGAGACTGTAGAGGCAGG + Intronic
1024604105 7:51010854-51010876 TTCAAAGAGGATGTACAAGAAGG - Intergenic
1026469164 7:70680100-70680122 TTCCATGAGAGTGGGGAGGAGGG + Intronic
1030770118 7:113464141-113464163 TACCTGGAGAATGTATAGGAGGG - Intergenic
1031120971 7:117721338-117721360 TTCCATCAAAATGTACTCGAGGG - Intronic
1031405965 7:121387531-121387553 TTCCATGAGAAACAACAGAATGG + Intronic
1032516776 7:132512272-132512294 ATCCATGTGTATGTACAGTAAGG - Intronic
1042104051 8:65305530-65305552 TGCCATGAGACTCTCCAGGAAGG + Intergenic
1044622832 8:94207286-94207308 TTCCATGAGAAAGTTCAAGTAGG - Intronic
1046018250 8:108632101-108632123 TGCTATAAGAATGCACAGGAAGG + Intronic
1047781248 8:128113181-128113203 TCCAATGGGAATGGACAGGAAGG - Intergenic
1047915204 8:129575549-129575571 GTCCATGAGAAGGTAGAGGGTGG - Intergenic
1048276304 8:133068565-133068587 TTCCATGAGAACACCCAGGAAGG - Intronic
1049036744 8:140082257-140082279 TTCCCTAAGAATTTAAAGGAAGG + Intronic
1049914090 9:299557-299579 TTCAAGGAAAATGTACAGGCTGG - Intronic
1050433648 9:5586978-5587000 ATACATGAGAAAGAACAGGATGG - Intergenic
1051560429 9:18435489-18435511 TACTATGAGAATATATAGGAGGG + Intergenic
1051837312 9:21355144-21355166 TTCCATAAGATTGAAGAGGAGGG + Intergenic
1052114162 9:24628655-24628677 TTCCATTAATATGTCCAGGATGG - Intergenic
1052575725 9:30288478-30288500 TTCCAGGACACAGTACAGGAAGG + Intergenic
1054862148 9:69965073-69965095 TACCAGGAGAATCTACATGAAGG - Intergenic
1055079544 9:72255718-72255740 TACCATGAGATTTTACGGGATGG - Intronic
1055153245 9:73028815-73028837 GTACATGAAAATGTAAAGGAGGG - Intronic
1055680593 9:78711173-78711195 TTCTTTGAGAAAGTACGGGATGG + Intergenic
1056581431 9:87889999-87890021 TTCCTTGGGGATGGACAGGAGGG - Intergenic
1058409429 9:104714976-104714998 TCCCATGATAATGTCAAGGAAGG - Intergenic
1058961421 9:109995890-109995912 TGCCATGAGGATGGAGAGGAAGG + Intronic
1060297077 9:122350144-122350166 TCCCAAGAGAAGGTCCAGGATGG + Intergenic
1061239164 9:129359153-129359175 CCCCATGAGACTGTCCAGGAGGG + Intergenic
1189965948 X:46373318-46373340 TTGCTTGAGAATGTACAGAAGGG + Intergenic
1193030331 X:76891232-76891254 TTCCATGACCATGTACTGAATGG - Intergenic
1193217693 X:78884017-78884039 TTCCATGCTCATGTATAGGAAGG + Intergenic
1195444766 X:104939636-104939658 TTCCATGGGAATGTTCATGGTGG + Intronic
1195726298 X:107920542-107920564 TTGCATGAGAATGAAAAGGAAGG - Intronic
1196073615 X:111550275-111550297 TTTCATGAGAATGTAATGGGAGG + Intergenic
1197080330 X:122405326-122405348 TATCATGAGAATGTATAGAATGG + Intergenic
1197179266 X:123516894-123516916 TGCCATGGGAGTGTAAAGGAGGG + Intergenic
1198039257 X:132833649-132833671 TTCCAGGAGCATTCACAGGAAGG + Intronic
1199388766 X:147255165-147255187 TTCCATGAGATAGTCCAGCAGGG + Intergenic
1199688276 X:150284114-150284136 TTCCATGTGAAGATACAGCAAGG - Intergenic
1201467731 Y:14302761-14302783 TTCAATAAGAAAGTACAGGCTGG - Intergenic
1202073185 Y:21013876-21013898 TTCCATGTGAGGGTACAGGTGGG - Intergenic
1202077885 Y:21055730-21055752 TTCCATGTGAGGGTACAGGTGGG - Intergenic
1202575661 Y:26321972-26321994 TGCTATGAGAGTGTAGAGGAGGG - Intergenic