ID: 1001593611

View in Genome Browser
Species Human (GRCh38)
Location 5:172883576-172883598
Sequence TAGGCAGGATCCCCCAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001593611 Original CRISPR TAGGCAGGATCCCCCAGAAG TGG Intronic
900320552 1:2081462-2081484 TGGGCATGGACCCCCAGAAGGGG + Intronic
900409165 1:2505063-2505085 CCGGCAGGGACCCCCAGAAGAGG + Exonic
904366087 1:30011793-30011815 AAAGCAGGAGCCCCCAGATGTGG + Intergenic
908099672 1:60777934-60777956 TGGGAAGCATCCCCCAGTAGGGG - Intergenic
908171602 1:61510715-61510737 TTGGCAGGATGCCCCATGAGAGG + Intergenic
910427334 1:87130601-87130623 TAGGCAGCATGACCCAGAGGAGG + Intronic
910933876 1:92470274-92470296 TAGCCAGGATACTCCTGAAGAGG + Intergenic
911991860 1:104707985-104708007 TAGGCAGGAACCACCACAACTGG + Intergenic
916255793 1:162786844-162786866 TAGACTGGATTCCCCAGAACTGG - Exonic
920681189 1:208074145-208074167 TAGGCAGGATCCAGCAGAAAAGG - Intronic
921793785 1:219319511-219319533 TCTGCAGAATCCCCCAGAATTGG - Intergenic
921892639 1:220368511-220368533 TAGGCACAATTCCCCAGATGTGG + Intergenic
922227791 1:223660587-223660609 TAGGCAGAAACGCCCAGCAGGGG + Intronic
922973295 1:229761166-229761188 TTGCCTGGATCCCCAAGAAGAGG - Intergenic
1062894012 10:1089247-1089269 GAGGCTGGATCCCTCAGAAGAGG - Intronic
1064474275 10:15669918-15669940 TGGGAAGGACCCCCCAGTAGCGG - Intronic
1065000099 10:21330706-21330728 TAGGCAGGACTCCCCAGGAAAGG + Intergenic
1066722256 10:38352513-38352535 TAGACTGGATTCCCCAGAACTGG - Intergenic
1067785848 10:49246339-49246361 TAGGAAGCACCCCCCAGCAGGGG + Intergenic
1068724319 10:60284186-60284208 AAGGCAGGGACCACCAGAAGTGG + Intronic
1070660391 10:78301672-78301694 AAGGCAGGCTCCTCCAGGAGAGG - Intergenic
1070934514 10:80282946-80282968 TAGGCAGGATGACCTGGAAGTGG + Intronic
1071524069 10:86348004-86348026 TAGACAGGCTCCCCCAGGAAGGG + Intronic
1076383380 10:130040017-130040039 TAGTGAGGATGCCCCAGGAGGGG + Intergenic
1077069226 11:660394-660416 CAGGCAGGGTCCCCCTGAAGTGG + Intronic
1077253514 11:1571096-1571118 GAGGCAGATTCTCCCAGAAGGGG + Intronic
1078740897 11:14065277-14065299 TTTGCAGGAACCCACAGAAGCGG + Intronic
1080059281 11:27939796-27939818 TAGGAAGCACCCCCCAGTAGGGG + Intergenic
1080291314 11:30674323-30674345 TAGGAGGCATCCCCCAGTAGGGG + Intergenic
1083400336 11:62418976-62418998 TAGGCAGCAGCACCCAGATGGGG - Intronic
1084797592 11:71518929-71518951 TGGGGAGGGTCCCCGAGAAGCGG + Intronic
1085782064 11:79418694-79418716 CAGGCAGGGTCTCACAGAAGAGG - Intronic
1087163194 11:94971459-94971481 TACTCAGGATGCCCCTGAAGAGG - Exonic
1087830184 11:102811062-102811084 GAGGCAGGATCCCTCAGATCTGG + Intergenic
1092718523 12:11416889-11416911 TAGGAGGGACCCCCCAGTAGGGG + Intronic
1095698343 12:45165359-45165381 TGGGCAGGATCTCCCAGCTGGGG - Intergenic
1097212974 12:57386551-57386573 TGCGCAGGAGCCCACAGAAGCGG - Intronic
1097875556 12:64639866-64639888 TGGCCAAGATCCACCAGAAGTGG - Intronic
1098585002 12:72144180-72144202 TAGGGAGGACACCACAGAAGAGG + Intronic
1099548150 12:84011185-84011207 TAGGAGGCATCCCCCAGCAGGGG - Intergenic
1104042738 12:125141116-125141138 TACCCAGCATCCCCCAGATGGGG + Intronic
1104923330 12:132302701-132302723 GGGGCAGGATCCCCAGGAAGAGG + Intronic
1106672340 13:31919881-31919903 TATGCAGTTTACCCCAGAAGAGG + Intergenic
1107831120 13:44374228-44374250 TCTGCAGGACCCCGCAGAAGGGG - Intronic
1109032373 13:57208483-57208505 TAGGCATGAGCCCCCATACGTGG - Intergenic
1119413734 14:74455825-74455847 GAGGGAGGAACACCCAGAAGCGG - Intergenic
1121280156 14:92692210-92692232 CAGGCAGGGTCCCCAAGAACTGG - Intergenic
1121868899 14:97389087-97389109 TACTCAGGATCCCACAGACGTGG - Intergenic
1122814152 14:104304051-104304073 TGGGCAGGATCCCCGAGGTGGGG - Intergenic
1122922701 14:104886545-104886567 GACGCAGGAGCCCCCAGGAGGGG + Exonic
1126102532 15:45128668-45128690 GAGGCAGGATTCCCCAGTAAGGG + Intronic
1127996439 15:64155701-64155723 CAGGCAGGATCCCAGGGAAGGGG + Exonic
1130655849 15:85791768-85791790 TATGCAGAATCCCCTAGAATGGG - Intronic
1132240552 15:100254209-100254231 TATGCAGTATCCCCAAGAATGGG + Intronic
1135388724 16:22069955-22069977 TGGGCAAGATCCCAAAGAAGGGG + Intronic
1135802535 16:25511409-25511431 TAGGCAGGAGCCACCACAACTGG - Intergenic
1137377916 16:47969887-47969909 AAGGCAGGATCTCCTAGTAGAGG - Intergenic
1140907193 16:79418893-79418915 AAGGCAGCAGCCCCCAGCAGAGG - Intergenic
1141411109 16:83833726-83833748 GAGTCAGGGTCCCCCAGCAGAGG - Intergenic
1141856100 16:86682507-86682529 TTGGCTGGAGCCCCCAGCAGCGG + Intergenic
1144073628 17:11697132-11697154 TAGGCATGAGCCACCAGAATAGG + Intronic
1144328868 17:14206718-14206740 CAGGCAGGCTCTCCCAGGAGAGG + Intronic
1144830224 17:18127010-18127032 GAGTCAGGGTGCCCCAGAAGAGG + Intronic
1145256183 17:21323705-21323727 AAGCCAGGTTCCCCCAGGAGGGG + Intergenic
1147948745 17:44095457-44095479 TAGGGATGAGGCCCCAGAAGGGG - Intronic
1149505339 17:57189477-57189499 TAGGCTGGAACTCCCAGAAGTGG - Intergenic
1150617535 17:66783907-66783929 TAGGCTGCATGCCCCCGAAGCGG - Intronic
1151545697 17:74791565-74791587 TAGACAGAATCGGCCAGAAGAGG - Intronic
1151896162 17:76982279-76982301 GATGCAGGATCTCCCAGAACAGG - Intergenic
1156308786 18:35904231-35904253 TAGGGAAGAAGCCCCAGAAGAGG - Intergenic
1162849592 19:13420572-13420594 TTGCCAGGAGCCACCAGAAGAGG + Intronic
1164362245 19:27526660-27526682 TTGGCAGGATCTCCAAAAAGAGG - Intergenic
1168096502 19:54118491-54118513 TAGACAGAATCTCCCAGAAGGGG + Intronic
925741421 2:7008639-7008661 GAAGCAGGCTCCACCAGAAGGGG - Intronic
926302914 2:11617258-11617280 TAGTCAGGATCCCGCAGAGGAGG + Intronic
926772128 2:16387640-16387662 TAGGCAGCAGCCCCCAGATCTGG + Intergenic
927855339 2:26524103-26524125 AAGGCAGGAAACCCCACAAGGGG - Intronic
927972746 2:27316033-27316055 TGGGCAGGAACACCCAGCAGGGG - Intronic
929578664 2:43068380-43068402 CGGGCAGGGTCCCCCAGGAGCGG + Intergenic
933813441 2:86047771-86047793 TCCCCAGGATCCCCCTGAAGGGG - Intronic
934778882 2:96956372-96956394 AAGGCAGGCTCCCCGGGAAGAGG + Intronic
934943622 2:98520344-98520366 TAGTCAGGCTCCAGCAGAAGCGG - Intronic
937277440 2:120694461-120694483 TAAGCAGCAGCTCCCAGAAGAGG + Intergenic
942135828 2:172924262-172924284 TAGGTGGGATCCCCCTGCAGTGG + Intronic
946363350 2:219233072-219233094 CATCAAGGATCCCCCAGAAGAGG + Exonic
946983931 2:225250235-225250257 AAGGCAAGATACCCCAGAACAGG - Intergenic
948868134 2:240785533-240785555 TCGGCAGGGTCCTCCAGAACAGG + Intronic
1170581784 20:17704864-17704886 CTGACAGGATCCCCCACAAGTGG + Intronic
1170965983 20:21072125-21072147 TAGGTTGGATTCTCCAGAAGCGG + Intergenic
1171750551 20:29044579-29044601 TAGGCATGATCCCCCTGCTGGGG - Intergenic
1172122519 20:32607374-32607396 TGGGCAGAAGCCCCCAGAACAGG - Intronic
1172597218 20:36157739-36157761 TGGCCAGGGTCCCCCAGAAGTGG + Intronic
1172787383 20:37478217-37478239 CTGGCTGGATCCCCCAGAAAAGG + Intergenic
1172795955 20:37537741-37537763 CAGGCAAGATCCTCCAGCAGAGG - Intergenic
1173110096 20:40178894-40178916 TTGGCAGGATACATCAGAAGGGG + Intergenic
1174111543 20:48201166-48201188 CAGGCAGGAGGCCCCAGCAGAGG - Intergenic
1175390200 20:58622246-58622268 TAGGCAGGCTCCCCCTGTATGGG - Intergenic
1176314656 21:5231337-5231359 TAGGCATGATCCCCCTGCTGGGG + Intergenic
1180392445 22:12297295-12297317 TAGGCATGATCCCCCTGCTGGGG + Intergenic
1180407303 22:12567473-12567495 TAGGCATGATCCCCCTGCTGGGG - Intergenic
1181447013 22:22984898-22984920 TAGGCAGGATCTTACTGAAGTGG + Intergenic
1181587062 22:23858475-23858497 TGGGAAGGAACCCCTAGAAGCGG - Intronic
1181747526 22:24966242-24966264 TAAACAGGACTCCCCAGAAGAGG - Intronic
1182045268 22:27269243-27269265 AAGGCAGGGACCCCAAGAAGAGG - Intergenic
1183591482 22:38781575-38781597 TAGTCAGGAGCCCAAAGAAGAGG - Intronic
1183719252 22:39552811-39552833 CTGGGGGGATCCCCCAGAAGCGG - Intergenic
1184376574 22:44117305-44117327 CAGGGAGGATCCCCCAAAGGAGG + Intronic
1185334732 22:50266448-50266470 GAGGCAAGACCCGCCAGAAGGGG + Intronic
949443603 3:4110329-4110351 TAGGAGGCATCCCCCAGTAGTGG - Intronic
950176847 3:10880949-10880971 TAGGGAGGGAACCCCAGAAGAGG - Intronic
951910951 3:27749850-27749872 TTGGCAGAATTCCACAGAAGTGG - Intergenic
955409643 3:58647341-58647363 TGGGCAGGATCCCTATGAAGGGG + Intronic
958125576 3:89350894-89350916 TGGGAAGCATCCCCCAGCAGGGG - Intronic
960255581 3:115507619-115507641 TAGTCAGTATCTTCCAGAAGTGG + Intergenic
962709944 3:138077821-138077843 TAGGCTGGAACCCACAGCAGTGG - Intronic
963554698 3:146772628-146772650 TCGGCAGGAGCCCACAGAGGCGG - Intergenic
967844482 3:194033007-194033029 TTGGCAGGATGACCCAGCAGCGG - Intergenic
968671251 4:1852975-1852997 TAGGGAGGCTCTCCCAGGAGTGG - Intronic
969103029 4:4784367-4784389 TGGACAGGATCTCCCTGAAGAGG - Intergenic
969596480 4:8151980-8152002 TAGGCAGGAACCCCCATAGGAGG + Intronic
974870275 4:67634500-67634522 TTAGCGGGATCCCCCAGAAGAGG - Exonic
982297415 4:153844050-153844072 TAGGCAAGGTCCCTGAGAAGTGG + Intergenic
983702245 4:170612123-170612145 TAGGCAGAATCCCTCATAAGGGG - Intergenic
984903026 4:184601381-184601403 TGGGAGGCATCCCCCAGAAGGGG + Intergenic
986569961 5:9154511-9154533 TGGTCAAGATCCCCCTGAAGAGG - Exonic
992417961 5:76570981-76571003 TAGGCATGAGCCACCAAAAGTGG - Intronic
997518762 5:134508782-134508804 AAGGCAGGATCCCCCACTAAAGG + Intergenic
999242510 5:150136134-150136156 TAGGCAGTAGGCACCAGAAGGGG + Intronic
1001593611 5:172883576-172883598 TAGGCAGGATCCCCCAGAAGTGG + Intronic
1003324495 6:5082404-5082426 GGGGCAGGGACCCCCAGAAGAGG - Intergenic
1003492948 6:6639810-6639832 TGTGCAGGACCCCCCAAAAGTGG - Intronic
1004677347 6:17855986-17856008 TAGGCATGATCCCCCACATCTGG + Intronic
1012687608 6:102272185-102272207 TAGACATGATCCCCAAAAAGTGG - Intergenic
1016555057 6:145327184-145327206 TATGCAGGATGCACCAGAAAAGG + Intergenic
1018899308 6:168043313-168043335 CAGGCAGAGTCCCCCAGAGGTGG + Intronic
1019938039 7:4269169-4269191 CAGGCAGCATCCCCCAAAATTGG + Intergenic
1020366303 7:7384280-7384302 TAAGGAGGCTCACCCAGAAGAGG + Intronic
1021175897 7:17449513-17449535 TAGGCAGGATCTCCCAGCTGGGG - Intergenic
1022109408 7:27219423-27219445 CAGGCAGGAACCCCCAGAAGAGG + Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1026106992 7:67429270-67429292 TTGGCAGCACCCCCCAGAAGAGG + Intergenic
1026196781 7:68180161-68180183 GAGGCAGGAGACCCTAGAAGTGG + Intergenic
1032226489 7:130035917-130035939 TAGACTGGATGCCCCATAAGAGG - Intronic
1034492489 7:151401173-151401195 TAGGCAGGACGCCCCAAGAGGGG - Intronic
1034523804 7:151641523-151641545 CAGGCAGGAGCCACCAGAACCGG + Intronic
1045794247 8:106024038-106024060 TAGGAGGCATCCCCCAGCAGGGG + Intergenic
1047749774 8:127871533-127871555 TAGGCAGAGTCCACCAGAATCGG + Intergenic
1047789576 8:128189145-128189167 TAGGCGGGCACACCCAGAAGAGG - Intergenic
1048205526 8:132412337-132412359 GAGTCAGAATCACCCAGAAGGGG - Intronic
1048659099 8:136575751-136575773 TTGGCAGGAGGGCCCAGAAGAGG - Intergenic
1049170602 8:141158466-141158488 TTGGCTAGATCCCCCAGAATGGG + Intronic
1049372893 8:142276124-142276146 AGGGCAGGAGCCCCCAGATGCGG - Intronic
1051425094 9:16924620-16924642 TATGCTGGATCCCCCAGCACTGG - Intergenic
1052311770 9:27075722-27075744 TGGGCAGGACCTCCCAGCAGGGG - Intergenic
1053462626 9:38282338-38282360 GTGGCAGGATCCCTCAGTAGCGG - Intergenic
1053663570 9:40301426-40301448 GAGGCAGGATCCCTCACAAATGG + Intronic
1053721625 9:40952211-40952233 TAGGCATGATCCCCCTGCTGCGG - Intergenic
1053914083 9:42931968-42931990 GAGGCAGGATCCCTCACAAATGG + Intergenic
1054344336 9:63899782-63899804 TAGGCATGATCCCCCTGCTGCGG + Intergenic
1054375693 9:64447660-64447682 GAGGCAGGATCCCTCACAAATGG + Intergenic
1054521045 9:66074859-66074881 GAGGCAGGATCCCTCACAAATGG - Intergenic
1056306329 9:85294452-85294474 TAGGTAGAATCTCCCAGCAGAGG - Intergenic
1056444868 9:86656096-86656118 GGGGCAGGATCCCAGAGAAGCGG - Intergenic
1057200174 9:93135504-93135526 CAGGCACTATCCCCCAGAATAGG - Intergenic
1060499082 9:124139242-124139264 TAACCAGAATCCTCCAGAAGTGG + Intergenic
1061802059 9:133118092-133118114 TCGGGAGGGTCCCCCAGAAGAGG - Intronic
1061905035 9:133692357-133692379 TAGGCATCAGCCCCCAGTAGAGG - Intronic
1062105661 9:134753471-134753493 AAGGCCAGATCCCCCAGATGTGG - Intronic
1203453532 Un_GL000219v1:143785-143807 TAGGCATGATCCCCCTGCTGCGG + Intergenic
1185923391 X:4119358-4119380 TTGGCAGGATCTCAGAGAAGAGG - Intergenic
1188769065 X:34130875-34130897 CAGGCAGGGTTCCCCACAAGGGG + Exonic
1189064823 X:37796189-37796211 TAGGCAGGATGCTCCATTAGAGG + Intronic
1192277467 X:69648402-69648424 TGGGCAGGATCTCCCAGTGGCGG - Intronic
1192343594 X:70283144-70283166 TAGACTGGATCCCTGAGAAGTGG - Intronic
1196896826 X:120344972-120344994 TAGGAGGCATCCCCCAGTAGAGG + Intergenic
1197797755 X:130316585-130316607 CTGCCAGGAACCCCCAGAAGTGG + Intergenic
1200854427 Y:7921917-7921939 TGGGCAGGATCCTGCAGGAGAGG + Intergenic
1201522991 Y:14897570-14897592 TATGCATGATCCACCAGAAATGG - Intergenic