ID: 1001594807

View in Genome Browser
Species Human (GRCh38)
Location 5:172891341-172891363
Sequence ATGGAGAAGAGGGAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3323
Summary {0: 1, 1: 2, 2: 48, 3: 398, 4: 2874}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001594807_1001594815 18 Left 1001594807 5:172891341-172891363 CCATCCTCTTCCCTCTTCTCCAT 0: 1
1: 2
2: 48
3: 398
4: 2874
Right 1001594815 5:172891382-172891404 GTCTGGTATGTTTAACAGTCAGG 0: 1
1: 0
2: 3
3: 4
4: 81
1001594807_1001594812 1 Left 1001594807 5:172891341-172891363 CCATCCTCTTCCCTCTTCTCCAT 0: 1
1: 2
2: 48
3: 398
4: 2874
Right 1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001594807 Original CRISPR ATGGAGAAGAGGGAAGAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr