ID: 1001594812

View in Genome Browser
Species Human (GRCh38)
Location 5:172891365-172891387
Sequence TCTGCAGTCTCTCCCTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 199}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001594807_1001594812 1 Left 1001594807 5:172891341-172891363 CCATCCTCTTCCCTCTTCTCCAT 0: 1
1: 2
2: 48
3: 398
4: 2874
Right 1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 199
1001594809_1001594812 -9 Left 1001594809 5:172891351-172891373 CCCTCTTCTCCATCTCTGCAGTC 0: 1
1: 0
2: 2
3: 62
4: 618
Right 1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 199
1001594803_1001594812 21 Left 1001594803 5:172891321-172891343 CCTACCGTCCACCAGTGGCTCCA 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 199
1001594800_1001594812 27 Left 1001594800 5:172891315-172891337 CCCATTCCTACCGTCCACCAGTG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 199
1001594799_1001594812 28 Left 1001594799 5:172891314-172891336 CCCCATTCCTACCGTCCACCAGT 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 199
1001594806_1001594812 10 Left 1001594806 5:172891332-172891354 CCAGTGGCTCCATCCTCTTCCCT 0: 1
1: 0
2: 5
3: 91
4: 606
Right 1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 199
1001594805_1001594812 13 Left 1001594805 5:172891329-172891351 CCACCAGTGGCTCCATCCTCTTC 0: 1
1: 1
2: 1
3: 32
4: 388
Right 1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 199
1001594801_1001594812 26 Left 1001594801 5:172891316-172891338 CCATTCCTACCGTCCACCAGTGG 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 199
1001594810_1001594812 -10 Left 1001594810 5:172891352-172891374 CCTCTTCTCCATCTCTGCAGTCT 0: 1
1: 0
2: 4
3: 63
4: 594
Right 1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 199
1001594808_1001594812 -3 Left 1001594808 5:172891345-172891367 CCTCTTCCCTCTTCTCCATCTCT 0: 1
1: 0
2: 30
3: 366
4: 2636
Right 1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 199
1001594804_1001594812 17 Left 1001594804 5:172891325-172891347 CCGTCCACCAGTGGCTCCATCCT 0: 1
1: 0
2: 5
3: 40
4: 357
Right 1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001594812 Original CRISPR TCTGCAGTCTCTCCCTTGTC TGG Intronic
902679418 1:18032572-18032594 TTGGAAGTCTTTCCCTTGTCGGG + Intergenic
902756491 1:18552617-18552639 TCTGCCCTCTCTCTTTTGTCAGG + Intergenic
903184915 1:21623348-21623370 TCTGCAGTGTGTCCCTGGCCTGG + Intronic
903872465 1:26446307-26446329 TCTGCAGTTTCTCCCTGATCAGG - Exonic
905092148 1:35438267-35438289 TCTCCAGTCTCTCCCATCTCAGG + Intronic
907802354 1:57782587-57782609 CCTGCTGTCTCTCTCTTGCCTGG + Intronic
908257195 1:62312688-62312710 TCTCCAGTCTCTGTCTTGGCAGG - Intronic
910953009 1:92671636-92671658 TCTGGAGTCTTTCCCATCTCAGG + Intronic
912311332 1:108624133-108624155 TCTGTAGACTCTCCCTGGGCAGG + Intronic
912503297 1:110136922-110136944 TCTGCAGTCTCCCCCAAGGCTGG + Intergenic
913272838 1:117110863-117110885 TCTGCGTTCTCACCCTTTTCTGG - Intergenic
919073007 1:192779618-192779640 TCTGCAGGCTGTTCCTTGTGCGG + Intergenic
920210139 1:204321952-204321974 TCTGCCTTCTCTCCCTTAGCAGG + Intronic
921732556 1:218594289-218594311 ACTTCAATCTCTCCCTTCTCTGG + Intergenic
922206870 1:223455683-223455705 GCTGCACTCTCTCCCTCTTCGGG + Intergenic
1063213601 10:3904046-3904068 TCTTCAGTCTTTCCCATCTCAGG - Intergenic
1063669349 10:8087468-8087490 CTTGCAGTTTCTCCCTTGTAAGG + Intergenic
1063718898 10:8558455-8558477 GCTTCAGTCTGTCCCTTGGCTGG + Intergenic
1063823044 10:9859808-9859830 TCAGCAGCCTCTGCCTTGTTTGG - Intergenic
1065917584 10:30365954-30365976 TCTGTAGTACCTCCCTTGTTGGG - Intronic
1065952714 10:30666571-30666593 GCGTCAGTCTCTCCCCTGTCCGG + Intergenic
1066952018 10:42128738-42128760 TCTGAGGTCTGCCCCTTGTCTGG + Intergenic
1067224111 10:44364152-44364174 TCTGCAGACTCCCCTGTGTCTGG - Intergenic
1067282887 10:44886244-44886266 TCTGCTGTCTCTCTGTTGTGTGG - Intergenic
1071617043 10:87084703-87084725 GCTGCACTCTCTCACTTTTCAGG + Intronic
1071780520 10:88839410-88839432 TCTGCAAGCTCTCCCATCTCTGG + Intronic
1081105881 11:39068476-39068498 CCTGCAGTCTGTACCTTTTCTGG - Intergenic
1081718944 11:45272395-45272417 TCTGCAGTCTCTGCCATGTTTGG + Intronic
1081921615 11:46783368-46783390 TCTGCTGTTTTTCCCTTTTCAGG - Exonic
1083721303 11:64604918-64604940 TCTGCTCTCTCACCCTTGTTAGG + Intergenic
1083734574 11:64672100-64672122 TCTGCACCCTCTCCCTTCTCTGG - Intronic
1089016057 11:115166438-115166460 TCACCAGTCCCTCCCTTGCCAGG - Intergenic
1090406250 11:126477308-126477330 TCTGCAGACTTTGCCTTGTTTGG + Intronic
1090473358 11:126999362-126999384 TCTTCTGTTTCTCCCCTGTCGGG - Intronic
1094396200 12:30008578-30008600 TGTGCAGTCTGACCCTGGTCTGG + Intergenic
1098293226 12:68978866-68978888 TTTGCAGTCACTTCCTTGTGTGG + Intergenic
1102030839 12:109739227-109739249 TCAGCAGTCTGCCCCTTGCCAGG - Intronic
1104340362 12:127943433-127943455 TCAGCAGCCTTTCCCATGTCAGG - Intergenic
1104661807 12:130616744-130616766 TCTGGAGTCTCTCCAGTGACAGG + Intronic
1104896551 12:132167714-132167736 TCTGCAGCCTCTTCCCTGCCCGG + Intergenic
1104922145 12:132296016-132296038 TCTGGAGGCTCTCCCTGTTCCGG - Intronic
1105433434 13:20357942-20357964 TCTGCCATCTCTGCCATGTCAGG - Intergenic
1105614278 13:21998384-21998406 GATGCCGTCTCTCACTTGTCAGG - Intergenic
1106284792 13:28309194-28309216 CCTCCAGTCTCTCCTATGTCTGG - Intronic
1106457826 13:29943066-29943088 TCTTCACTGTCTCCCTTGACAGG + Intergenic
1108095727 13:46898518-46898540 CCTGCAGTCCCTTCCTTGTGGGG + Intergenic
1110360534 13:74620235-74620257 TTTGCAGTCTCTTTCTTGCCTGG + Intergenic
1110405381 13:75144842-75144864 TCTGCTCTCTCTCCCATGTGAGG + Intergenic
1112029966 13:95447945-95447967 TATGCCGCCTCTCCCTTGCCAGG + Intronic
1112739779 13:102459770-102459792 TCTGAAGCCTCTCCCATGTTTGG + Intergenic
1114644981 14:24250567-24250589 TTTGCAGTCTTTGCCTTGTGTGG + Intronic
1115890342 14:38019553-38019575 TCTAGAATCTCTCCATTGTCTGG + Intronic
1117703710 14:58441274-58441296 ACTGCAGTCTCTACCTCCTCAGG + Exonic
1119298476 14:73552411-73552433 TCTGCAGCCTCTTCCTTGCCCGG + Intronic
1119302773 14:73584598-73584620 TCTGCAGCCTCTTCCTTGCCCGG + Intergenic
1119768683 14:77206519-77206541 TCTCCTCTCTCTCCCCTGTCAGG - Intronic
1120038717 14:79728284-79728306 ACTGCAGACTCTCCCTGGGCTGG - Intronic
1120403394 14:84063030-84063052 TATGCTGACTCTCGCTTGTCAGG - Intergenic
1120557352 14:85945121-85945143 TCAGCAGTGGCTCCCTTGTGTGG - Intergenic
1121427549 14:93863349-93863371 TATGCACCCTCTCCCTTTTCTGG - Intergenic
1122243867 14:100387177-100387199 TCCTCAGCCTCTCCCTTGTCAGG - Intronic
1122965722 14:105124476-105124498 TGTGTTGTCTCTCCCTTGGCAGG + Intergenic
1124886796 15:33694743-33694765 TCTGCAGTCCCTGCCTAGTGAGG + Intronic
1126377299 15:48009021-48009043 TCTGCACTCTTTACCTTGACTGG + Intergenic
1126444163 15:48723369-48723391 CCTGCAGCCTCTCCCTTATATGG + Intronic
1126459569 15:48900622-48900644 CCTGCATTCTCTCTCTTATCTGG + Intronic
1128737907 15:70063863-70063885 CCTGCAGTTTCTCCCTGCTCTGG - Intronic
1129303800 15:74643580-74643602 GCTGCAGTCTGCCCCTTGTCAGG + Intronic
1129663545 15:77566700-77566722 CCTGCACTCTCTCCCATCTCAGG - Intergenic
1129760588 15:78127189-78127211 TCTGCTGTCTTTCCCTTCTCTGG + Intronic
1131541273 15:93277381-93277403 TCTGCAGACTCTCCCTTCATCGG - Intergenic
1132661021 16:1061591-1061613 TCAGCTGCCTCTCCCTTCTCTGG + Intergenic
1134262053 16:12659161-12659183 TCTAGAGTCACTCTCTTGTCTGG + Intergenic
1136050870 16:27648989-27649011 TCTGCATTCTCTCCCTGTACAGG - Intronic
1136425357 16:30166486-30166508 TCTGCAGACCCTCTCTTTTCAGG - Intergenic
1138534172 16:57651178-57651200 TCTGCAGCCTCTGCCTCCTCAGG + Exonic
1139646179 16:68332478-68332500 TCAGCAGGGTTTCCCTTGTCTGG + Intronic
1140248000 16:73268741-73268763 ACTGCATTCTCTCCTTGGTCAGG + Intergenic
1140406028 16:74712165-74712187 TCTGCTGTGTCTCCCTGCTCTGG - Intergenic
1141493156 16:84388630-84388652 TCTCCAATGTCACCCTTGTCAGG + Intronic
1141955988 16:87371600-87371622 CCTGCTGTCTCTCCCCTTTCTGG - Intronic
1144389255 17:14778454-14778476 ACTGCAGCCTCTCCCTTTTGGGG - Intergenic
1147182276 17:38693878-38693900 TCTGCACTCTCTCCCTCTCCTGG - Intergenic
1147976457 17:44250741-44250763 TCTGCAGGCCCTCCCCTGCCAGG - Intronic
1148698007 17:49572734-49572756 TTTTCTGTCTCTCCCTTGCCAGG + Intergenic
1148967178 17:51446063-51446085 GCTGCACTGTCTCCCTTGTGTGG - Intergenic
1151496938 17:74463539-74463561 TCTGGAGTCTCTTCCTGGTGTGG - Intergenic
1152037362 17:77881465-77881487 GCTTCTGTCTCTGCCTTGTCAGG - Intergenic
1152232536 17:79121327-79121349 GCTGCAGTCTCTCCCGTGACAGG + Intronic
1152820228 17:82434061-82434083 TCTGCAGGCTGTCCCGTGCCAGG - Intronic
1154306244 18:13232898-13232920 TCTGCTGGCTCTCCCTGGTGTGG + Intronic
1155572124 18:27206356-27206378 CTTGCTGTCTCTCCCTTGACTGG - Intergenic
1157586359 18:48803910-48803932 TCTCCCCTCTCTCCCTTGTCTGG - Intronic
1157622150 18:49022859-49022881 GCTGCAGGCTCTCCCTTCCCTGG + Intergenic
1158830528 18:61272752-61272774 TCTCCAGTTTCTCCCCTCTCAGG + Intergenic
1160556013 18:79725758-79725780 TCTCCAGTCCCTCCCTTGCTGGG + Intronic
1162080594 19:8215538-8215560 CCTGCAGTCGCTCCCTTCCCAGG + Intronic
1162316329 19:9940521-9940543 ACTGCAGTCTCGACCTTCTCAGG - Intergenic
1163633064 19:18426816-18426838 TCTGCAGACTGTCCCCAGTCAGG - Intronic
1164521126 19:28980717-28980739 TTTGCTGTCTCTTCCGTGTCAGG - Intergenic
1164540836 19:29120429-29120451 GCTGCAGGCTCTCCCAGGTCTGG - Intergenic
1164982676 19:32626110-32626132 TCTTCAGTCTCTCAAGTGTCAGG - Intronic
1165895916 19:39140747-39140769 CCTGCAGCCTCTCCCTGCTCCGG + Intronic
925004832 2:433829-433851 TCTGCAGTCCCTCCTTTGAGGGG - Intergenic
925129032 2:1481529-1481551 TCTGCAGTCCCTCCGGGGTCTGG - Intronic
930723710 2:54662833-54662855 TCTGCAGTCTGTCACTTGCAAGG + Intronic
931438115 2:62266563-62266585 TTTGCTGGCTCTCCCTTCTCAGG - Intergenic
932861712 2:75299527-75299549 TCGTCAGTCTCTCCCTTTTCAGG - Intergenic
933626844 2:84610838-84610860 TCTGTAGTCCCTCCCTTCACAGG - Intronic
933837429 2:86257096-86257118 TCTTCAGCCTCTCTCTTTTCTGG - Intronic
936760719 2:115777979-115778001 GCACCAGTCTCTCCCTTGACAGG + Intronic
940520948 2:154747510-154747532 TCTGTATTCTCTCCCTTTCCAGG + Intronic
943756749 2:191565104-191565126 TCTGCCCTCTCTCTCTTCTCTGG + Intergenic
944481660 2:200163612-200163634 TCTCCAGTCTCTTCCTTGTCAGG + Intergenic
946179168 2:217939734-217939756 TCTGCAGTCCCTGCCTTTTTAGG - Intronic
948071218 2:235128025-235128047 TCTGCATACGCTCTCTTGTCTGG - Intergenic
1169711744 20:8571962-8571984 TCTGCAATCTCTCTCTTGACTGG + Intronic
1170947117 20:20901106-20901128 TCTGCAGGTTCTCCTTTGGCTGG + Intergenic
1172786416 20:37471813-37471835 TCTGCTGTGTCTCCCGTGTCTGG + Intergenic
1173222765 20:41143013-41143035 TCAGCAGTCCCTCTATTGTCAGG + Intronic
1173882820 20:46431005-46431027 GCTGCAGCCTCTCCCTTGGGAGG - Intronic
1174068575 20:47883641-47883663 ACTGAAGTCTCTCCCTTGCATGG - Intergenic
1176031820 20:63016511-63016533 TCTGCACTCGCTCCCCTGTATGG + Intergenic
1177047208 21:16185282-16185304 TCTGCTTTCTCTCCTTTTTCTGG - Intergenic
1179046422 21:37849150-37849172 TCTGCAGTCTTTTCCCTGTCAGG + Intronic
1182857680 22:33532418-33532440 TCTTTAGTCTCCCCCTTGTCAGG - Intronic
1182898752 22:33880509-33880531 TGTGCAGTCTCTGCCATGTGCGG + Intronic
1184106769 22:42371931-42371953 TCTTCTGGCTCTGCCTTGTCAGG - Intergenic
1184326424 22:43790945-43790967 CCTGCAGTCTTTCCCATCTCAGG - Intronic
1184398924 22:44262297-44262319 TCTGCAGACTCACCCCTGCCAGG - Intronic
951081265 3:18452889-18452911 GCTGCACTCTCTCCTTTATCAGG + Intergenic
952735982 3:36692006-36692028 TCTTCAGTCTCTCCATCTTCTGG - Intergenic
952959176 3:38579152-38579174 TGTACCGTCTCTCCCCTGTCAGG + Intronic
954873003 3:53781853-53781875 ACTGAAGCCTCTCCTTTGTCTGG - Intronic
955996853 3:64687397-64687419 TTTGCAGCCTCTCCCTTCTTTGG - Intronic
956349371 3:68317781-68317803 TCTGTAGTCTCTCTCTCTTCTGG + Intronic
958759641 3:98291988-98292010 TGGGAAGTCTCTTCCTTGTCTGG + Intergenic
959836189 3:110920933-110920955 TCTGCAGTCTCTGGCTTCACTGG - Intergenic
960216059 3:115038932-115038954 TTTGCATTCTCTCCCTTTACTGG + Intronic
960437817 3:117648686-117648708 TCTACAGTTTCTCCCCTGACTGG + Intergenic
960822816 3:121752368-121752390 TCTGCAGTCTCTAACTGCTCTGG - Intergenic
961241767 3:125417473-125417495 TCTGGAGTCTCTCCCTGGCCTGG - Intergenic
962606782 3:137038694-137038716 TCTCCTGTCTCTCCCTTATGAGG - Intergenic
965297661 3:166969895-166969917 TCTCCACTATCTCCCTTGCCAGG - Intergenic
968481003 4:833030-833052 TCTGGAGCCTCTTCCTTCTCAGG + Intergenic
968866998 4:3219450-3219472 ACTGCAGTCTCTCCCTGGGTGGG + Intronic
974261143 4:59525544-59525566 ACTGCAACCTCTGCCTTGTCAGG + Intergenic
974718511 4:65703814-65703836 TCTCCACTTTCTCACTTGTCAGG - Intergenic
976399146 4:84587934-84587956 TCTGAAGGTTCTCTCTTGTCTGG - Intronic
976651059 4:87435171-87435193 ACTGCAGTCTCTGTCTTGGCTGG + Exonic
978021314 4:103816755-103816777 TCTGCAGTATCTCCTTTTCCTGG - Intergenic
978292917 4:107167482-107167504 TTTGCAGTCTCTCACTTTCCAGG + Intronic
978840771 4:113209340-113209362 TCTGTGGGCCCTCCCTTGTCTGG - Intronic
981823242 4:148910360-148910382 TCTGCAGTCTCTCCCAATTATGG - Intergenic
984087846 4:175334181-175334203 TGTGCATTTTCTCCCTGGTCAGG - Intergenic
985775801 5:1841155-1841177 TCTGCACTCTGTCCCTCCTCAGG + Intergenic
986293406 5:6418172-6418194 ACTGCAGTCTCTCTCGTGGCCGG - Intergenic
991516418 5:67440835-67440857 TCTTCTATCTCTCTCTTGTCAGG - Intergenic
995192891 5:109338247-109338269 TCTTCAGTCTTTCTCCTGTCAGG - Intronic
996332403 5:122345056-122345078 GCTGCATTCTCTACCTTGTTGGG - Intronic
996837623 5:127811235-127811257 TCTCCATTCCCTCCCTTGTTGGG + Intergenic
997750690 5:136342509-136342531 TCATCTGTCTCTCCCTAGTCAGG + Intronic
998507973 5:142687228-142687250 TCTCCAGTCTCTACCTCCTCTGG + Intronic
1000285778 5:159825236-159825258 TCTGAAGCCTGTCCCTTGTTGGG - Intergenic
1001594812 5:172891365-172891387 TCTGCAGTCTCTCCCTTGTCTGG + Intronic
1002055559 5:176596401-176596423 TATGCAGTCTCTCCCTGTTCTGG + Exonic
1002430497 5:179200737-179200759 CCTGCAGTCTTTCCCTTCCCAGG - Intronic
1002863098 6:1097166-1097188 TCTGCAGTGCCTGCCTTGTCTGG + Intergenic
1003121375 6:3321661-3321683 TCTGCCACTTCTCCCTTGTCAGG + Intronic
1003564973 6:7215053-7215075 TCTGCCTTCTCTCCCTCATCTGG - Intronic
1004126838 6:12882269-12882291 TCTCCAATCTCTCCCTTCTCAGG - Intronic
1004442251 6:15664553-15664575 TCTCCAAACTGTCCCTTGTCTGG + Intergenic
1004991136 6:21139952-21139974 TTTGCAGTCTTTCCCTTATTAGG - Intronic
1006165788 6:32064067-32064089 ACTGCAGTCTTTCCCTTCTGAGG - Intronic
1006468256 6:34209350-34209372 CCTGCAGTCCCTCCCTACTCTGG + Intergenic
1010723051 6:79305405-79305427 TTTGTGGTATCTCCCTTGTCTGG + Intergenic
1014221169 6:118800207-118800229 TGTGCAGTCTATCACTTGTGTGG + Intergenic
1015670402 6:135683243-135683265 TCTGCAGTGTGGCCCTTGCCAGG + Intergenic
1016933180 6:149428868-149428890 TCTGCAGTCTCTCCCAGCACAGG + Intergenic
1023463014 7:40421118-40421140 TCTGCAAAGTCTACCTTGTCAGG + Intronic
1023600804 7:41880234-41880256 TCTGCAGTGTCTGTCTGGTCTGG - Intergenic
1024902339 7:54334160-54334182 TTTGATGTCTCTCCCTTCTCTGG + Intergenic
1027779864 7:82507768-82507790 TCTTCAGGCCCTCCCTTGCCCGG + Intergenic
1029582684 7:101447834-101447856 GCTGGAGTTTCTCCCTTCTCTGG + Intronic
1031122139 7:117733971-117733993 TCCTCAGTCTCTTCCTTATCAGG - Intronic
1032011255 7:128349670-128349692 TCTGTAATCCCTCCCTTGCCTGG - Intergenic
1032259681 7:130325048-130325070 TAAGCAGTCTTTCCCTTGGCCGG - Intergenic
1032363724 7:131279728-131279750 ACTGCAGTCTCCACCTTGCCAGG - Intronic
1034210810 7:149360436-149360458 TCTCCTGTCTCTCCCTCCTCGGG + Intergenic
1034725678 7:153333121-153333143 TCTCCATTGTCTCCCTTGTGTGG + Intergenic
1037241719 8:16785155-16785177 TCTGGAGTCTGTCCCTTCTGAGG - Intergenic
1037920232 8:22800753-22800775 TCTGCAGCCCCTCCCTGGGCAGG - Intronic
1038420877 8:27433398-27433420 TCTGGGGTCTCACCCTTGGCTGG + Intronic
1038583067 8:28766817-28766839 TCTGTAGCCTATCCCTTGACTGG + Intergenic
1040639292 8:49313637-49313659 TCTACAGTAACACCCTTGTCAGG + Intergenic
1046439271 8:114236942-114236964 TCTGCAGGCTCTCCCTAGCAGGG + Intergenic
1047021911 8:120784544-120784566 TCAGGTGTCTCTCCTTTGTCCGG - Intronic
1047517267 8:125565947-125565969 TCTGCTGACTCTCCCTTATAAGG + Intergenic
1048902380 8:139051117-139051139 CCTGCAGTCTCTTCCTTGAAGGG - Intergenic
1049200655 8:141338815-141338837 TCTCCAGACTCTCCCTTTCCCGG + Intergenic
1050000462 9:1072025-1072047 TCTGAAGTCTCACCCGTGGCTGG - Intergenic
1050013542 9:1209421-1209443 TCTCCACTCCCTCCCTGGTCTGG - Intergenic
1050135976 9:2465106-2465128 TCTGCTGACTCTCCCTTATTTGG + Intergenic
1050601610 9:7258416-7258438 TCTGCATTCTCATCCCTGTCTGG + Intergenic
1052058333 9:23927937-23927959 TATGCAGTTTCTTCTTTGTCAGG - Intergenic
1053161751 9:35818375-35818397 TAGGCAGTCTCTCCCTGGGCTGG + Exonic
1056092081 9:83215492-83215514 TCTGCGTGCTCCCCCTTGTCAGG + Intergenic
1056778999 9:89535483-89535505 ATTGCAGTCTTTACCTTGTCAGG + Intergenic
1057809948 9:98250187-98250209 TCTGCTCTCTCTCCTTTGCCTGG - Intronic
1058379807 9:104364949-104364971 TCTGTAGCCCCTCCCTCGTCAGG + Intergenic
1059882450 9:118706581-118706603 TCTTCTGTCTGTCCCTTTTCTGG - Intergenic
1061782748 9:133005354-133005376 TCTAAAGACTCTCCATTGTCTGG + Intergenic
1186454991 X:9703730-9703752 TCGGCTCTCTCCCCCTTGTCTGG + Intronic
1187682373 X:21780240-21780262 TCTCCAGTCACTCCCATCTCAGG + Intergenic
1188999533 X:36928981-36929003 TCAGCAGTCTCTCCCTTTCCAGG + Intergenic
1189878127 X:45458106-45458128 TCTGCAGCCTCACCAATGTCTGG + Intergenic
1192490017 X:71568386-71568408 TCTGCAGTCTTTACATTGCCAGG - Intronic
1192795048 X:74420003-74420025 TATGCAGTCTTTCACTTATCAGG + Intergenic
1196122678 X:112067457-112067479 TCTGCCGTCTCAGCTTTGTCAGG + Intronic
1196264807 X:113630238-113630260 TCTGCATTTTGTCCCTTGACAGG - Intergenic
1199621690 X:149706940-149706962 TCTGAACACTCTCTCTTGTCAGG - Intronic
1199954402 X:152732578-152732600 TCTTCAGTCTCACCCTGGACTGG - Intronic