ID: 1001594815

View in Genome Browser
Species Human (GRCh38)
Location 5:172891382-172891404
Sequence GTCTGGTATGTTTAACAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 81}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001594808_1001594815 14 Left 1001594808 5:172891345-172891367 CCTCTTCCCTCTTCTCCATCTCT 0: 1
1: 0
2: 30
3: 366
4: 2636
Right 1001594815 5:172891382-172891404 GTCTGGTATGTTTAACAGTCAGG 0: 1
1: 0
2: 3
3: 4
4: 81
1001594806_1001594815 27 Left 1001594806 5:172891332-172891354 CCAGTGGCTCCATCCTCTTCCCT 0: 1
1: 0
2: 5
3: 91
4: 606
Right 1001594815 5:172891382-172891404 GTCTGGTATGTTTAACAGTCAGG 0: 1
1: 0
2: 3
3: 4
4: 81
1001594809_1001594815 8 Left 1001594809 5:172891351-172891373 CCCTCTTCTCCATCTCTGCAGTC 0: 1
1: 0
2: 2
3: 62
4: 618
Right 1001594815 5:172891382-172891404 GTCTGGTATGTTTAACAGTCAGG 0: 1
1: 0
2: 3
3: 4
4: 81
1001594807_1001594815 18 Left 1001594807 5:172891341-172891363 CCATCCTCTTCCCTCTTCTCCAT 0: 1
1: 2
2: 48
3: 398
4: 2874
Right 1001594815 5:172891382-172891404 GTCTGGTATGTTTAACAGTCAGG 0: 1
1: 0
2: 3
3: 4
4: 81
1001594805_1001594815 30 Left 1001594805 5:172891329-172891351 CCACCAGTGGCTCCATCCTCTTC 0: 1
1: 1
2: 1
3: 32
4: 388
Right 1001594815 5:172891382-172891404 GTCTGGTATGTTTAACAGTCAGG 0: 1
1: 0
2: 3
3: 4
4: 81
1001594811_1001594815 -1 Left 1001594811 5:172891360-172891382 CCATCTCTGCAGTCTCTCCCTTG 0: 1
1: 0
2: 3
3: 62
4: 576
Right 1001594815 5:172891382-172891404 GTCTGGTATGTTTAACAGTCAGG 0: 1
1: 0
2: 3
3: 4
4: 81
1001594810_1001594815 7 Left 1001594810 5:172891352-172891374 CCTCTTCTCCATCTCTGCAGTCT 0: 1
1: 0
2: 4
3: 63
4: 594
Right 1001594815 5:172891382-172891404 GTCTGGTATGTTTAACAGTCAGG 0: 1
1: 0
2: 3
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001594815 Original CRISPR GTCTGGTATGTTTAACAGTC AGG Intronic
903299568 1:22369064-22369086 GTCTTGTATGTTGCACAGGCTGG - Intergenic
904104708 1:28069498-28069520 ATCTGGTATGTTGACCAGCCTGG + Intronic
905555057 1:38875947-38875969 GTCTGGAATGATGAGCAGTCTGG - Exonic
908205277 1:61841720-61841742 GTGTGGTTTGTTCAACAGTAAGG - Intronic
909348866 1:74624923-74624945 GTCTTGTATGTTGGCCAGTCTGG + Intronic
910619248 1:89235484-89235506 GTTTGTTTTGTTCAACAGTCTGG + Intergenic
919675622 1:200379492-200379514 GTCTGGAATGTCTCACAGCCAGG + Intergenic
922778768 1:228233057-228233079 GTCTGGTAGGTTTAAGAATTGGG + Intronic
1071856366 10:89628776-89628798 GTCTGTTTTGTTTAAGAGTATGG - Intronic
1077065399 11:638884-638906 GCCTGGTATGTTTCCCAGGCTGG - Intronic
1085458121 11:76677139-76677161 GTCTGGTATGTTTGTGAGTGTGG - Intergenic
1085548289 11:77341915-77341937 GTCTGTCATGTTTATTAGTCAGG - Intronic
1091842912 12:3633450-3633472 GTCTGCTCTGTTCAACAGACAGG - Intronic
1093240500 12:16665056-16665078 GTGTGGAATGTTCCACAGTCTGG - Intergenic
1094562521 12:31568943-31568965 GTCTGGTATGTTGCTCAGACTGG + Intronic
1097409349 12:59231444-59231466 TGCTGTTATGTTTAAGAGTCTGG + Intergenic
1098081629 12:66791995-66792017 GCCTGGAAAGTTTAACATTCTGG + Intronic
1099948940 12:89278401-89278423 GTCTTGTATCTTGAACAGTGTGG - Intergenic
1102196297 12:111027726-111027748 GTGTGGTATGTGTATGAGTCAGG + Intergenic
1103156659 12:118691065-118691087 GTTTGCAATGTTTAAAAGTCTGG + Intergenic
1103178633 12:118887900-118887922 GTCTCGTATGTTGCCCAGTCTGG + Intergenic
1109462535 13:62680411-62680433 GTCTGGTTCCTTTTACAGTCTGG - Intergenic
1111508323 13:89225774-89225796 GACTGGTCTGTTTTACATTCCGG - Intergenic
1116141944 14:41007508-41007530 CTATTGTATGTATAACAGTCCGG + Intergenic
1119565943 14:75629570-75629592 CTCTGGTGTGTTTCACAGTAGGG + Intronic
1120431117 14:84417415-84417437 GTATGGTATGCTTAACTGGCAGG + Intergenic
1126407892 15:48340550-48340572 GTCTGGTAAGTATAACTCTCTGG + Intronic
1127512848 15:59659905-59659927 GTCTGGCATGTTTAACAGTAAGG - Exonic
1128975338 15:72148718-72148740 TTCTGTTATATTTAACAGACAGG + Intergenic
1129536843 15:76320170-76320192 GGCTGGTTTGGTAAACAGTCTGG + Intergenic
1130196891 15:81788177-81788199 GTCTGGTCTCTTTAACACACTGG - Intergenic
1130582269 15:85148431-85148453 GTCTGGTATGTGTATGAGTCTGG - Intergenic
1132467684 16:85070-85092 GTCATGTGTTTTTAACAGTCTGG + Intronic
1138516671 16:57539646-57539668 GTCTGCTATGTTTCCCAGGCTGG + Intergenic
1140984418 16:80144250-80144272 TTCTGGTATCTGTAACAGTGAGG + Intergenic
1144059707 17:11571802-11571824 GTATAGTATGCTTAAAAGTCAGG + Intergenic
1148261382 17:46186700-46186722 GTCTGATAAGTTGAACTGTCAGG - Intronic
1151227842 17:72659947-72659969 GGCTGGGGTGTTTAACACTCAGG - Intronic
1159222627 18:65484605-65484627 GCCTGCTATCTTTAAAAGTCGGG - Intergenic
1164792745 19:31002052-31002074 TTCTGGTATGTCTTAGAGTCAGG - Intergenic
1165636137 19:37341742-37341764 GTATCTTATGTGTAACAGTCTGG + Intronic
1166011905 19:39948964-39948986 GTCTGGGGTGTCTAACAGTGGGG + Intergenic
1166989170 19:46680639-46680661 ATCTGGTGTGTATAACAGTTGGG - Intronic
930699130 2:54441498-54441520 GTCTGGTATGTTTCATAGGTTGG + Intergenic
931104304 2:59037746-59037768 TTGTGGTATGTTTATAAGTCAGG - Intergenic
934543721 2:95197156-95197178 CTCTGGCATGTTCAACAGTCTGG - Intergenic
935708533 2:105877259-105877281 CTCTGGTATCCTTAGCAGTCAGG + Intronic
936236569 2:110747440-110747462 CTCTGGTGTGTTTAACAGCTGGG + Intronic
940634415 2:156280535-156280557 GTCTGGTAAGGTTAACAGTCTGG + Intergenic
944350584 2:198722473-198722495 TTCTGATATGTTAAACAATCTGG - Intergenic
1175791215 20:61741037-61741059 GTCTTGTATGTTTAGTAGACAGG - Intronic
1177486962 21:21770924-21770946 GTCTGTTTTGTTTGACAGCCGGG + Intergenic
1177570873 21:22885177-22885199 GTCTGGTATGTTGAACCCTAGGG - Intergenic
1178560647 21:33636355-33636377 GTTTTGTATGTTTAAGAGACAGG - Intronic
1178973086 21:37198355-37198377 GTGTGGTATTTTGAACAGTTGGG + Intronic
956870653 3:73413912-73413934 GAATGGTATGTTTAACAAGCAGG + Intronic
958120998 3:89287999-89288021 TTCTGGTATGTTTTCCTGTCAGG - Intronic
960808714 3:121608576-121608598 GTCTGGTGTGTCTAACAGTAAGG + Intronic
966646241 3:182248765-182248787 GTCTGGTATGTTTTAAAATATGG - Intergenic
967297778 3:187982179-187982201 GGCAGTAATGTTTAACAGTCTGG - Intergenic
970243623 4:14035304-14035326 GGCTGTTATGCTTAACAGCCAGG - Intergenic
972361569 4:38330491-38330513 GCCAGGGATGTTTATCAGTCAGG + Intergenic
975269214 4:72409813-72409835 GTTTTGTATGTTTCACAGTTGGG - Intronic
978362248 4:107943649-107943671 GTCTGGTATGTTTGACTGCATGG + Intronic
978680536 4:111376425-111376447 GACTGGTATATCTAACAGTTTGG + Intergenic
979514162 4:121587779-121587801 GTCTGCTATGTTAAACAGTCTGG - Intergenic
982948112 4:161652403-161652425 GTCTGGTTTGTTGTACAGGCTGG - Intronic
987258971 5:16184471-16184493 TTCTGGGATGTTTTAAAGTCTGG - Intergenic
997617147 5:135255223-135255245 GTCTGGTTTGTTTTACTGTTAGG - Intronic
1001594815 5:172891382-172891404 GTCTGGTATGTTTAACAGTCAGG + Intronic
1006177627 6:32132084-32132106 GTCTGCTGTGTTTACCAGGCTGG + Intergenic
1006688308 6:35856583-35856605 GGCTGTTATGTATAACTGTCTGG - Intronic
1010731898 6:79399966-79399988 GTCTAGCAGGTTTAACACTCAGG + Intergenic
1019999813 7:4749361-4749383 GGCTGTTGTGTTTAACAGTGAGG + Intronic
1020774661 7:12437875-12437897 TTTTGATATGTTTAACAATCTGG - Intergenic
1022022813 7:26417176-26417198 GTCTGTTATGTTTAACACAGTGG - Intergenic
1022795196 7:33726634-33726656 GTCTGGTATGCTTAACAATTTGG - Intronic
1030346317 7:108436834-108436856 ATCTGATATGTATAACAGTTTGG + Intronic
1041175298 8:55190691-55190713 GTGTGGTATGCTGAACAGACAGG + Intronic
1044267090 8:90194741-90194763 GTCTAGTATGTTGCCCAGTCTGG + Intergenic
1045313446 8:101023538-101023560 GTATGGCATGATTAACATTCCGG - Intergenic
1045983712 8:108222343-108222365 GTCTGCCATGTTTCAAAGTCTGG - Intronic
1048473905 8:134726085-134726107 GTCTGGAATTGTTAACAGTGGGG + Intergenic
1055199014 9:73634297-73634319 GTAAGGTATATTTAACAGTGTGG + Intergenic
1056759263 9:89403757-89403779 GTCTGCTTTATTTAAGAGTCAGG + Intronic
1056982907 9:91333050-91333072 GGCTGGTTTGTTTAACCTTCAGG + Intronic
1057901539 9:98952935-98952957 TTGTGCTATGTTTTACAGTCTGG + Intronic
1189676885 X:43469864-43469886 GTGTGGTATGTTTCACTTTCGGG - Intergenic
1190457658 X:50641577-50641599 GTAAGGTATGTTTCACAGTGTGG - Intronic