ID: 1001596548

View in Genome Browser
Species Human (GRCh38)
Location 5:172902375-172902397
Sequence CAGGCTGGGTAGAGGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001596540_1001596548 -2 Left 1001596540 5:172902354-172902376 CCTTGAGCCTGGGTTGTGAGCCA 0: 1
1: 0
2: 1
3: 21
4: 224
Right 1001596548 5:172902375-172902397 CAGGCTGGGTAGAGGGCCCCAGG No data
1001596539_1001596548 2 Left 1001596539 5:172902350-172902372 CCTGCCTTGAGCCTGGGTTGTGA 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1001596548 5:172902375-172902397 CAGGCTGGGTAGAGGGCCCCAGG No data
1001596543_1001596548 -9 Left 1001596543 5:172902361-172902383 CCTGGGTTGTGAGCCAGGCTGGG 0: 1
1: 0
2: 0
3: 29
4: 332
Right 1001596548 5:172902375-172902397 CAGGCTGGGTAGAGGGCCCCAGG No data
1001596536_1001596548 10 Left 1001596536 5:172902342-172902364 CCAGGTTGCCTGCCTTGAGCCTG 0: 1
1: 0
2: 3
3: 30
4: 255
Right 1001596548 5:172902375-172902397 CAGGCTGGGTAGAGGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001596548 Original CRISPR CAGGCTGGGTAGAGGGCCCC AGG Intronic
No off target data available for this crispr