ID: 1001597449

View in Genome Browser
Species Human (GRCh38)
Location 5:172907194-172907216
Sequence TCTTCCTTGCAGCAGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001597437_1001597449 19 Left 1001597437 5:172907152-172907174 CCCTGCCTGGTCTCCCTCTTGCA 0: 1
1: 0
2: 3
3: 41
4: 407
Right 1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG No data
1001597441_1001597449 5 Left 1001597441 5:172907166-172907188 CCTCTTGCACAGCAGCCCCTCCA 0: 1
1: 0
2: 3
3: 33
4: 399
Right 1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG No data
1001597435_1001597449 24 Left 1001597435 5:172907147-172907169 CCATCCCCTGCCTGGTCTCCCTC 0: 1
1: 0
2: 14
3: 138
4: 1296
Right 1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG No data
1001597444_1001597449 -10 Left 1001597444 5:172907181-172907203 CCCCTCCAGTGGGTCTTCCTTGC 0: 1
1: 0
2: 0
3: 19
4: 210
Right 1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG No data
1001597439_1001597449 14 Left 1001597439 5:172907157-172907179 CCTGGTCTCCCTCTTGCACAGCA 0: 1
1: 0
2: 4
3: 20
4: 218
Right 1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG No data
1001597440_1001597449 6 Left 1001597440 5:172907165-172907187 CCCTCTTGCACAGCAGCCCCTCC 0: 1
1: 0
2: 2
3: 40
4: 396
Right 1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG No data
1001597436_1001597449 20 Left 1001597436 5:172907151-172907173 CCCCTGCCTGGTCTCCCTCTTGC 0: 1
1: 0
2: 3
3: 82
4: 1562
Right 1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG No data
1001597438_1001597449 18 Left 1001597438 5:172907153-172907175 CCTGCCTGGTCTCCCTCTTGCAC 0: 1
1: 0
2: 2
3: 43
4: 403
Right 1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG No data
1001597434_1001597449 27 Left 1001597434 5:172907144-172907166 CCGCCATCCCCTGCCTGGTCTCC 0: 1
1: 0
2: 5
3: 142
4: 1210
Right 1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001597449 Original CRISPR TCTTCCTTGCAGCAGCCAGA GGG Intronic
No off target data available for this crispr