ID: 1001598064

View in Genome Browser
Species Human (GRCh38)
Location 5:172911006-172911028
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001598064_1001598073 9 Left 1001598064 5:172911006-172911028 CCATGGTCCCTAGACTTGTCAGC 0: 1
1: 0
2: 0
3: 8
4: 154
Right 1001598073 5:172911038-172911060 GGGCGCCCTCTCCTGGACTGGGG No data
1001598064_1001598070 2 Left 1001598064 5:172911006-172911028 CCATGGTCCCTAGACTTGTCAGC 0: 1
1: 0
2: 0
3: 8
4: 154
Right 1001598070 5:172911031-172911053 GTGGACTGGGCGCCCTCTCCTGG No data
1001598064_1001598072 8 Left 1001598064 5:172911006-172911028 CCATGGTCCCTAGACTTGTCAGC 0: 1
1: 0
2: 0
3: 8
4: 154
Right 1001598072 5:172911037-172911059 TGGGCGCCCTCTCCTGGACTGGG 0: 1
1: 0
2: 1
3: 9
4: 177
1001598064_1001598071 7 Left 1001598064 5:172911006-172911028 CCATGGTCCCTAGACTTGTCAGC 0: 1
1: 0
2: 0
3: 8
4: 154
Right 1001598071 5:172911036-172911058 CTGGGCGCCCTCTCCTGGACTGG 0: 1
1: 0
2: 0
3: 21
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001598064 Original CRISPR GCTGACAAGTCTAGGGACCA TGG (reversed) Intronic