ID: 1001598066

View in Genome Browser
Species Human (GRCh38)
Location 5:172911013-172911035
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001598066_1001598071 0 Left 1001598066 5:172911013-172911035 CCCTAGACTTGTCAGCGAGTGGA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1001598071 5:172911036-172911058 CTGGGCGCCCTCTCCTGGACTGG 0: 1
1: 0
2: 0
3: 21
4: 197
1001598066_1001598072 1 Left 1001598066 5:172911013-172911035 CCCTAGACTTGTCAGCGAGTGGA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1001598072 5:172911037-172911059 TGGGCGCCCTCTCCTGGACTGGG 0: 1
1: 0
2: 1
3: 9
4: 177
1001598066_1001598078 29 Left 1001598066 5:172911013-172911035 CCCTAGACTTGTCAGCGAGTGGA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1001598078 5:172911065-172911087 AGCCGTCCCTCTGCCCAGCCTGG 0: 1
1: 1
2: 2
3: 36
4: 307
1001598066_1001598070 -5 Left 1001598066 5:172911013-172911035 CCCTAGACTTGTCAGCGAGTGGA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1001598070 5:172911031-172911053 GTGGACTGGGCGCCCTCTCCTGG No data
1001598066_1001598073 2 Left 1001598066 5:172911013-172911035 CCCTAGACTTGTCAGCGAGTGGA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1001598073 5:172911038-172911060 GGGCGCCCTCTCCTGGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001598066 Original CRISPR TCCACTCGCTGACAAGTCTA GGG (reversed) Intronic