ID: 1001598067

View in Genome Browser
Species Human (GRCh38)
Location 5:172911014-172911036
Sequence GTCCACTCGCTGACAAGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 39}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001598067_1001598070 -6 Left 1001598067 5:172911014-172911036 CCTAGACTTGTCAGCGAGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1001598070 5:172911031-172911053 GTGGACTGGGCGCCCTCTCCTGG No data
1001598067_1001598078 28 Left 1001598067 5:172911014-172911036 CCTAGACTTGTCAGCGAGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1001598078 5:172911065-172911087 AGCCGTCCCTCTGCCCAGCCTGG 0: 1
1: 1
2: 2
3: 36
4: 307
1001598067_1001598071 -1 Left 1001598067 5:172911014-172911036 CCTAGACTTGTCAGCGAGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1001598071 5:172911036-172911058 CTGGGCGCCCTCTCCTGGACTGG 0: 1
1: 0
2: 0
3: 21
4: 197
1001598067_1001598072 0 Left 1001598067 5:172911014-172911036 CCTAGACTTGTCAGCGAGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1001598072 5:172911037-172911059 TGGGCGCCCTCTCCTGGACTGGG 0: 1
1: 0
2: 1
3: 9
4: 177
1001598067_1001598073 1 Left 1001598067 5:172911014-172911036 CCTAGACTTGTCAGCGAGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1001598073 5:172911038-172911060 GGGCGCCCTCTCCTGGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001598067 Original CRISPR GTCCACTCGCTGACAAGTCT AGG (reversed) Intronic