ID: 1001598073

View in Genome Browser
Species Human (GRCh38)
Location 5:172911038-172911060
Sequence GGGCGCCCTCTCCTGGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001598067_1001598073 1 Left 1001598067 5:172911014-172911036 CCTAGACTTGTCAGCGAGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1001598073 5:172911038-172911060 GGGCGCCCTCTCCTGGACTGGGG No data
1001598064_1001598073 9 Left 1001598064 5:172911006-172911028 CCATGGTCCCTAGACTTGTCAGC 0: 1
1: 0
2: 0
3: 8
4: 154
Right 1001598073 5:172911038-172911060 GGGCGCCCTCTCCTGGACTGGGG No data
1001598066_1001598073 2 Left 1001598066 5:172911013-172911035 CCCTAGACTTGTCAGCGAGTGGA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1001598073 5:172911038-172911060 GGGCGCCCTCTCCTGGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001598073 Original CRISPR GGGCGCCCTCTCCTGGACTG GGG Intronic