ID: 1001598346

View in Genome Browser
Species Human (GRCh38)
Location 5:172912923-172912945
Sequence CATGCCCAGCTAATGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 896
Summary {0: 1, 1: 14, 2: 93, 3: 267, 4: 521}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001598342_1001598346 8 Left 1001598342 5:172912892-172912914 CCAAGTAGCTGGGATTACAGGCA 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
Right 1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG 0: 1
1: 14
2: 93
3: 267
4: 521
1001598337_1001598346 18 Left 1001598337 5:172912882-172912904 CCTCAGCCTCCCAAGTAGCTGGG 0: 89011
1: 200457
2: 243521
3: 257984
4: 301655
Right 1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG 0: 1
1: 14
2: 93
3: 267
4: 521
1001598339_1001598346 12 Left 1001598339 5:172912888-172912910 CCTCCCAAGTAGCTGGGATTACA 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
Right 1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG 0: 1
1: 14
2: 93
3: 267
4: 521
1001598341_1001598346 9 Left 1001598341 5:172912891-172912913 CCCAAGTAGCTGGGATTACAGGC 0: 35616
1: 158937
2: 257753
3: 440394
4: 391946
Right 1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG 0: 1
1: 14
2: 93
3: 267
4: 521
1001598335_1001598346 22 Left 1001598335 5:172912878-172912900 CCTGCCTCAGCCTCCCAAGTAGC 0: 74529
1: 175606
2: 216051
3: 220891
4: 278507
Right 1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG 0: 1
1: 14
2: 93
3: 267
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001598346 Original CRISPR CATGCCCAGCTAATGTTTTG TGG Intronic
900274397 1:1814643-1814665 CATGCCTGGCTAATATTTTTTGG - Intronic
900588896 1:3450298-3450320 CATGCCCAGCTGATCCTTTGGGG + Intergenic
900627730 1:3616975-3616997 CAAGCACAGCTATTGTTCTGAGG + Intergenic
901282934 1:8053271-8053293 CACGCCTGGCTAATTTTTTGTGG - Intergenic
901299733 1:8190891-8190913 CATGCCCAGCTATTTTTTTTTGG + Intergenic
901515577 1:9743702-9743724 CATGCCCAGCTAATTTTCGTGGG + Intronic
901596414 1:10389010-10389032 CACGCCCAGCTAATTTTGGGGGG + Intergenic
902029893 1:13414613-13414635 CACGCCCAGCTAATTTTTGTGGG + Intronic
903184487 1:21621709-21621731 CATGCCCAGCTGAGGTTGTGTGG - Intronic
903389025 1:22951160-22951182 CATGCCTGGCTAATTTTTTTTGG - Intergenic
903424183 1:23241090-23241112 CATGCCCAGCTAATTTTTGTGGG - Intergenic
903433285 1:23326015-23326037 TATGCCCAGCTAATATCTGGGGG + Intronic
903592546 1:24468156-24468178 CATGCCTGGCTAATTTTTTGTGG - Intronic
903783005 1:25834458-25834480 CACGCCCAGCTAATTTTTTTTGG - Exonic
903881948 1:26516550-26516572 GACGCCCAGCTAATTTTTGGTGG + Intergenic
904154358 1:28470537-28470559 CATGCCCGGCTAATTTTTGGGGG - Intronic
904711199 1:32431829-32431851 CATGCCCAGCTAATTTTTACAGG + Intergenic
904739784 1:32664740-32664762 CGTGCCCAGCCACTTTTTTGGGG + Intronic
905416845 1:37809370-37809392 CATGTCCATTTCATGTTTTGGGG + Exonic
905776635 1:40671917-40671939 CATGCCCAGCTAATTATTTTTGG + Intergenic
906209902 1:44006972-44006994 CATGCCAGGCTAAGGGTTTGAGG - Intronic
906261114 1:44391005-44391027 GATGCCCAGCTAATTTTTTTTGG + Intergenic
906283994 1:44573959-44573981 CACGCCCAGCTCATATTTTTTGG - Intronic
906359070 1:45137218-45137240 CATGCCCAGCTAATTTTTTTAGG + Intronic
906420006 1:45657694-45657716 CATGCCCAGCTAACTTTTTTGGG - Intronic
907199385 1:52713276-52713298 TATGCCTAGCTAGTTTTTTGTGG - Intergenic
907206454 1:52776060-52776082 CACGCCCGGCTAATTTTTTTGGG - Intronic
907272999 1:53301572-53301594 CATGCCCAGCTAATTTTTTTTGG - Intronic
907463882 1:54622580-54622602 CATACCCAGCTAATTTTTTGTGG - Intronic
907497821 1:54856442-54856464 CACGCCCGGCTAATTTTTTTTGG - Intronic
907507750 1:54933658-54933680 CACGCCTGGCTAATTTTTTGTGG + Intergenic
908469578 1:64430624-64430646 CATGCCCAGCTAATTTTTGTGGG + Intergenic
908955495 1:69621199-69621221 CATGCCCGGCTAATTTTTTATGG + Intronic
909018704 1:70407710-70407732 CATGCCAGGCTAATTTTTTGTGG - Intergenic
909710342 1:78642423-78642445 CATACCCAGCTAATTTTTGTGGG - Exonic
910006793 1:82407064-82407086 CATGCCCAGCTAATATTTTTTGG - Intergenic
910217472 1:84856809-84856831 CTTGTCAAGCTAATGCTTTGTGG + Intronic
910448510 1:87324016-87324038 CACGCCCAGCTAATTTTTTTTGG - Intergenic
910862256 1:91753231-91753253 CATGACCAGCTGATTTTTTTTGG - Intronic
910895990 1:92070057-92070079 CATACCCAGCTAAACATTTGAGG - Intergenic
911186696 1:94911610-94911632 CATGCCCAGCTAATTTTTGTGGG - Intronic
911442444 1:97944207-97944229 CACGCCCAGCTAATTTTTGTGGG + Intergenic
912398187 1:109365377-109365399 CATGCCCAGCTAATTTTGTGAGG + Intronic
912455706 1:109795583-109795605 CACGCCCGGCTAATTTTTTTTGG + Intergenic
912476832 1:109943508-109943530 CATGCCTGGCTAATTTTTTATGG + Intergenic
912886975 1:113484879-113484901 CACGCCCAGCTAATTTTTTTTGG + Intronic
913525074 1:119683488-119683510 CACGCCCAGCTAACTTTTTAAGG - Intronic
914687041 1:149989581-149989603 CATGCCCAGCTAATTTTTGTGGG - Intronic
914724808 1:150318629-150318651 CACGCCCGGCTAATTTTTTGTGG - Intergenic
914865003 1:151419510-151419532 TATGCCCAGCTAATTTTGGGGGG - Intronic
914949457 1:152099794-152099816 CATGCCCAGGTAATTTTTTTTGG + Intergenic
915115560 1:153596938-153596960 CACGCCCGGCTAATTTTTGGGGG + Intergenic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
915477885 1:156163873-156163895 CAGGCCCAGCTCATTTTTTTTGG - Intronic
916227365 1:162502017-162502039 CACACCCAGCTAATTTTTTGAGG - Intronic
916518417 1:165541557-165541579 CATGCCCAGCTAATTTTTTTTGG - Intergenic
916552171 1:165859668-165859690 CACACCCTGCTAATTTTTTGTGG - Intronic
916929126 1:169556641-169556663 CTTGCCTTGCAAATGTTTTGGGG + Exonic
917294130 1:173501665-173501687 CACGCCCAGCTAATTTTTGGTGG + Intronic
917487919 1:175471979-175472001 CATGCCCAGCTAGTGTGCTTTGG - Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918577788 1:186084626-186084648 CATGGCCAGCTTAATTTTTGTGG + Intronic
918590919 1:186240243-186240265 CATGCCTAGCTAATTTGGTGGGG + Intergenic
918745049 1:188187993-188188015 CATCCCCAGCTGATGATCTGTGG + Intergenic
918777662 1:188655858-188655880 CAGGCCCAGCTAATTTTTGTGGG + Intergenic
920148039 1:203879755-203879777 CATGCCCGGCTAATTTTTTACGG - Intergenic
920655883 1:207874446-207874468 CACGCCCAGCTAATTTTTTGTGG - Intergenic
920982397 1:210850352-210850374 CACGCCCAGCTACTTTTTTTTGG - Intronic
921203958 1:212832173-212832195 CATGCCCAGCTAATTTTTGTGGG + Intronic
922320961 1:224486260-224486282 CATGCCCAGCTAATTTTTGTGGG + Intronic
922498302 1:226077970-226077992 CACGCCCAGCTAATTTTTGTGGG + Intergenic
922523515 1:226279002-226279024 CATGCCCTGCTAATTTTTTGTGG - Intronic
922708116 1:227802109-227802131 CACGCCCAGCTAACTTTTTTGGG + Intergenic
922782818 1:228267061-228267083 CATGCCTAGCTAATTTTTTAAGG + Intronic
923107679 1:230867539-230867561 AATGCCCAGCGTATGTTTTAAGG - Intronic
923372149 1:233325517-233325539 CACGCCCAGCTAATTTTTTTTGG - Intergenic
923713368 1:236404644-236404666 CATGCCCAGCTAATGTATGGGGG - Intronic
923928547 1:238664724-238664746 CATACCCAGCTAATATTTTTTGG - Intergenic
924635621 1:245785004-245785026 CGTGCCCAGCTAATTGTTTTGGG + Intronic
924763868 1:247013271-247013293 TACGCCCGGCTAATTTTTTGTGG - Intergenic
1062865348 10:847681-847703 CAGGCCCAGCTAATTTTTTTTGG + Intronic
1063672668 10:8112061-8112083 CATGCCCAGCTAATTTTTGTGGG + Intergenic
1064039523 10:11947628-11947650 CATGCCCAGCTAATTATTTTGGG - Intronic
1064053498 10:12078453-12078475 CATGCCCGGCTAATTTTTGTGGG - Intronic
1064203611 10:13304353-13304375 CACGCTCAGCTAATTTTCTGGGG - Intergenic
1064661538 10:17612763-17612785 CACGCCCGGCTAATTTTTTTTGG - Intronic
1064714841 10:18166410-18166432 CATGTCCAGCTAATTTTTGTTGG + Intronic
1065069529 10:22008180-22008202 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1065141949 10:22726637-22726659 CATGACCAGCAAAAGTCTTGAGG + Intergenic
1065545485 10:26815752-26815774 CATACCCAGCTAATTTTTTTGGG - Intronic
1065559571 10:26948836-26948858 CACGCCCAGCTAATTTTTTTGGG - Intergenic
1065798050 10:29325006-29325028 CATGCCTAGCTAATTTTTTTTGG - Intergenic
1066002400 10:31116693-31116715 CATGCCCCGCAAAAGTTATGAGG - Intergenic
1066207945 10:33208215-33208237 CACGCCGAGCTAATTTTTTGTGG + Intronic
1066233327 10:33459853-33459875 CATGTCCAGCTGATGCTTTCAGG - Intergenic
1066251873 10:33641105-33641127 CGAGCCCGGCTAATTTTTTGGGG - Intergenic
1066373807 10:34839454-34839476 CATGCCTAGTTAATTTTTTGTGG + Intergenic
1066487055 10:35856216-35856238 TATGCCCAGTTGATGTATTGGGG - Intergenic
1066651799 10:37663256-37663278 CATGCCCAGCTAAAATGTAGAGG + Intergenic
1067035560 10:42913570-42913592 CATGCCCAGCTAAAATGTAGAGG + Intergenic
1067379337 10:45758762-45758784 CATGCCCGGCTAATTTTTTGTGG + Intronic
1067887037 10:50099424-50099446 CATGCCCGGCTAATTTTTTGTGG + Intronic
1070049903 10:72878272-72878294 CATGCCCAGCTAGGATTTTTTGG + Intronic
1070134511 10:73680572-73680594 TATGCCCAGATAATTTTTTTTGG + Intronic
1070324800 10:75381377-75381399 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1070620406 10:78005320-78005342 CATGCCCGGCTAATTTTTTAAGG - Intronic
1070995396 10:80774650-80774672 CATGCCCAGTTAATTTTTGTGGG - Intergenic
1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG + Intergenic
1071746408 10:88424539-88424561 TATGCCCAGCTGATGACTTGAGG + Intronic
1071948629 10:90677405-90677427 CATGCCTGGCTAATTTTTTGTGG + Intergenic
1072115077 10:92363021-92363043 CATGTCCAGCTAATTTTTTTTGG - Intergenic
1072153719 10:92704712-92704734 CATGCCTAGCTAATTTTTAGGGG - Intergenic
1072162852 10:92784471-92784493 CATGCCCAACTAATTTTTGTGGG + Intergenic
1072315779 10:94201630-94201652 CAAGCCCGGCTAATTTTTTTTGG + Intronic
1072849356 10:98871224-98871246 TATGCCCAGTTTATATTTTGGGG + Intronic
1072919261 10:99562110-99562132 CATGCCGAGATAATTTTTCGGGG + Intergenic
1072952725 10:99861938-99861960 TATGCCCAGCTAATTTTTGTGGG + Intergenic
1073010448 10:100355085-100355107 CATGCCTGGCTAATTTTTTGTGG + Intronic
1073252649 10:102130889-102130911 CATGCCCAGCTAATTTTTTGGGG - Intergenic
1073589195 10:104740005-104740027 AAAGACCAGCTAATATTTTGTGG - Intronic
1073756350 10:106585065-106585087 CATGCCTGGCTAATTTTTTTTGG - Intronic
1074505606 10:114067722-114067744 CATGCCCAGCCTTTTTTTTGAGG + Intergenic
1074770094 10:116727912-116727934 CATGCCCGACTAATTTTTTTGGG + Intronic
1075468167 10:122667580-122667602 CACGCCCAGCTAATGATAGGTGG + Intergenic
1075680500 10:124327628-124327650 CATGCCTGGTTAATTTTTTGTGG - Intergenic
1075774343 10:124970414-124970436 AATGCCTAGCTAATATTTTGGGG + Intronic
1075786588 10:125054025-125054047 CATGGCCCTCTACTGTTTTGTGG - Intronic
1075878935 10:125832963-125832985 CATACCCGGCTAATTTTTTGTGG - Intronic
1076042706 10:127264815-127264837 CGTGCCCAGCTAATTTTTTGTGG + Intronic
1078692979 11:13600657-13600679 CATGACAGGCTAATTTTTTGTGG + Intergenic
1079051460 11:17164193-17164215 CACACCCAGCTAATTTTTTTGGG - Intronic
1079105750 11:17571350-17571372 CATGCCCAACTATTGTTCTGGGG - Intronic
1080191882 11:29560267-29560289 CACGCCCAGCTACTTTTTTGGGG - Intergenic
1081116094 11:39203395-39203417 CATGCCCAGCTAATTTTTAGTGG - Intergenic
1081163725 11:39784391-39784413 CACGCCCTGCTAATTTTTTTTGG + Intergenic
1081170911 11:39869159-39869181 CATGCCCAGCTAAGTTTTGTGGG - Intergenic
1081443632 11:43107981-43108003 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1081486671 11:43536036-43536058 CACGTCCAGCTAATTTTTTTTGG + Intergenic
1081704974 11:45177366-45177388 CCTGCCCAGCAAAAGTCTTGGGG - Intronic
1082951768 11:58824005-58824027 CATGCTCAGCTAATTTGTGGTGG - Intergenic
1083825235 11:65198814-65198836 CATGCCCAGATAATTTTTTTTGG + Intronic
1083907224 11:65680975-65680997 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1083916869 11:65752066-65752088 CATACCCAGCTAATTTTTTTTGG + Intergenic
1083942461 11:65903841-65903863 TACGCCCAGCTAATTTTTTTTGG + Intergenic
1084156537 11:67316251-67316273 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1084167379 11:67381989-67382011 CATGCCTGGCTAATTTTTTGGGG - Intronic
1084318907 11:68362532-68362554 CACACCCAGCTAATTTTTGGGGG - Intronic
1084365805 11:68697392-68697414 CACGCCTGGCTAATTTTTTGTGG + Intergenic
1084777303 11:71385982-71386004 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1084842965 11:71872569-71872591 CACGCCCAGCTATTTTTTTTTGG - Intronic
1085211704 11:74786387-74786409 CATGCCCTGCTAATTGTTGGGGG + Intronic
1085288116 11:75377375-75377397 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1085378002 11:76084905-76084927 CATGCCTGGCTAATTTTTGGGGG - Intronic
1085927909 11:81044046-81044068 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1086083585 11:82931506-82931528 CATGCCCAGCTAATTTTTGTGGG + Intronic
1087717205 11:101622117-101622139 CATGCCCAGATAATTTTTTTTGG - Intronic
1087818726 11:102687869-102687891 CACGCCTGGCTAATTTTTTGTGG + Intergenic
1088467946 11:110161975-110161997 TATGCCCAGCTAATTTTTTTTGG - Intronic
1089028403 11:115296105-115296127 CATGCCCAGCTAATATTTTTTGG + Intronic
1089514134 11:119020860-119020882 CACACCCAGCTAATTTTTTGTGG + Intronic
1089705864 11:120277132-120277154 CATGCCCGGCTAAACTTTTTTGG - Intronic
1089898455 11:121956222-121956244 CATGCCCGGCTAATTTCTTCCGG - Intergenic
1090299204 11:125620095-125620117 CCTGACCAGCCAATGTTCTGTGG - Exonic
1090798167 11:130153335-130153357 CACGCCCAGCTAACTTTTTGGGG - Intergenic
1090819350 11:130327098-130327120 CATGCCCAGCCAATTTATTGTGG + Intergenic
1090958064 11:131531293-131531315 CATGCTCTGCTAATTTTTTTTGG + Intronic
1091079011 11:132648656-132648678 CATGCCCAGCTAATTTTTTCTGG + Intronic
1091981955 12:4871788-4871810 CATGCACAGCTAGTGTTTGATGG - Intergenic
1092124966 12:6068624-6068646 CATGCCCAGCTAATTTCTGTGGG + Intronic
1092233558 12:6791723-6791745 CATGCCCAGCTAACTTTTGTGGG - Intronic
1092291343 12:7161071-7161093 GATGCCAAGCTGATGTTCTGGGG + Intergenic
1092782425 12:11999470-11999492 CATGTCCAGCTAATTTTTGTAGG + Intergenic
1093406327 12:18809492-18809514 CACGCCCGGCTAATTTTTTGTGG + Intergenic
1093454989 12:19356360-19356382 CATGCCTGGCTAATTTTTTTTGG - Intronic
1094106289 12:26815172-26815194 CATGCCTGGCTAATTTTTGGTGG - Intronic
1094106691 12:26819912-26819934 CATGCCCAGCTAATTTTTTTGGG - Intronic
1094538750 12:31345307-31345329 CACGCCCAGCTAATTTTTCTGGG + Intergenic
1094644948 12:32313822-32313844 CGTGCCCAGCTAATTTTTTCTGG - Intronic
1094646465 12:32329259-32329281 CATGCCTGGCTAACTTTTTGTGG + Intronic
1095156162 12:38857737-38857759 CATGCCCGGCTATTTTTTTTGGG - Intronic
1095207086 12:39450663-39450685 CATGCCCAGCTAATTTTTTAAGG + Intergenic
1095438307 12:42215767-42215789 CATGCCTGGCTAATGTTTTTTGG - Intronic
1095456908 12:42396881-42396903 CATGCCCAGCTAATTTTTTGTGG - Intronic
1096246989 12:49996478-49996500 CATGCCCGGCTAATTTTTTTTGG - Intronic
1096308497 12:50499888-50499910 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1096719315 12:53509275-53509297 CAATCACAGCTAACGTTTTGAGG - Intronic
1097220280 12:57445899-57445921 CATGCCTGGCTAATTTTTGGTGG + Intronic
1097690868 12:62733409-62733431 CATACCCAGCTGATTTTTTTTGG + Intronic
1097719796 12:63008243-63008265 CATGCCAAACAAATATTTTGGGG - Intergenic
1098044083 12:66382080-66382102 CATGCCCAGCTAATTTTGAGGGG - Intronic
1098414785 12:70220542-70220564 CATGCCCAGCTAATTTTTGTTGG + Intergenic
1098543951 12:71690304-71690326 CATGCCCAGCTAATTTTTTCTGG + Intronic
1100069474 12:90694548-90694570 CATGCCCGGCTAATTTTTTTTGG + Intergenic
1100302217 12:93318342-93318364 CATGCCTGGCTAATTTTTTTGGG - Intergenic
1100534351 12:95492719-95492741 AACGCCCAGCTAATTTTTTTTGG + Intronic
1100551843 12:95653297-95653319 CACACCCAGCTAATTTTTTGTGG + Intergenic
1100662023 12:96709875-96709897 CACGCCCAGCTAATTTTTTGTGG + Intronic
1101844737 12:108353774-108353796 CATGCCCAGTTAATTTTTTATGG + Intergenic
1102327950 12:112004769-112004791 CATGTCCAGCTATTTTTATGGGG + Intronic
1102450067 12:113035292-113035314 CATGCCTAGCTAATTTTTGTAGG - Intergenic
1103076729 12:117989346-117989368 CATGCCTGGCTAGTTTTTTGTGG + Intergenic
1103501271 12:121404541-121404563 CACACCCAGCTAATTTTTTTTGG + Intronic
1104308094 12:127628139-127628161 CATGGAGAGCTAATATTTTGGGG + Intergenic
1104859724 12:131917808-131917830 CCTGCTCACCTCATGTTTTGGGG - Intronic
1105009974 12:132749150-132749172 CACGCCCAGCTGATTTTTTTGGG + Intronic
1105288614 13:19029939-19029961 CATGCCCGGCTAATTTTTGTGGG - Intergenic
1105438596 13:20397771-20397793 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1105464049 13:20620720-20620742 CACGCCTGGCTAATTTTTTGTGG + Intronic
1106151945 13:27113076-27113098 CATGCTCAGCTAATTTTTTAAGG - Intronic
1107479762 13:40776368-40776390 CATACCCAGCTAACTTTTTTTGG - Intergenic
1107484127 13:40810313-40810335 CATGTCCAGCTAATTTTTTTTGG + Intergenic
1108042992 13:46356860-46356882 CATGCCCAGCTAGCTTTTTTTGG + Intronic
1108415695 13:50196260-50196282 CATGCCGGGCTAATTTTTTTTGG + Intronic
1109408854 13:61938181-61938203 CATGCCCAGCTAATTTTTGGGGG + Intergenic
1109739379 13:66532145-66532167 CATGTCCAGCTATTTTTTAGTGG + Intronic
1109982662 13:69928999-69929021 TATGCTCAAATAATGTTTTGTGG + Intronic
1109988902 13:70027859-70027881 CATGCACAGTTAATTTTTAGAGG + Intronic
1109991129 13:70059312-70059334 TATGCCCAGCTAATTGTTTTTGG + Intronic
1111925484 13:94459031-94459053 CATGCCCAGCTAATTTGTAAAGG + Intronic
1111926490 13:94468843-94468865 CAGGCCCAGCCAGTGTTGTGTGG + Exonic
1112018857 13:95354149-95354171 CAAGCCTGGCTAATGTTTTTTGG - Intergenic
1112287672 13:98118441-98118463 CAAGCCCAGCTAATTTTTAGTGG + Intergenic
1112748163 13:102551583-102551605 CAAGCCCGGCTAATTTTTTTTGG - Intergenic
1113626272 13:111850186-111850208 TATGCCTGGCTAATTTTTTGTGG - Intergenic
1113840726 13:113359426-113359448 CATGCCCAGCTAATTTTTAAGGG - Intronic
1114667426 14:24387652-24387674 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1115231286 14:31163444-31163466 CACGCCCAGCTAATTCTTTGGGG - Intronic
1115242464 14:31263263-31263285 CATGCCCGGCTAATTTTTGCGGG + Intergenic
1115816612 14:37170791-37170813 CATGCCCGGCTAGTTTTTTGGGG - Intronic
1115838623 14:37439995-37440017 CATGCCTGGCTAATTTGTTGGGG + Intronic
1115935828 14:38551306-38551328 CATTCCCAGAGAATGTTTTAAGG + Intergenic
1116742227 14:48770954-48770976 CATGCCCAGCTAATTTTTGTAGG - Intergenic
1116920320 14:50565326-50565348 CATGCCCAGCTAATTTGGGGTGG - Intronic
1116989677 14:51262162-51262184 CATGCCCAGCTAAATTTTGGGGG + Intergenic
1117151481 14:52892609-52892631 CACGTCCAGCTAATTTTTTTTGG + Intronic
1117362956 14:54996441-54996463 CATGCCTGGCTAATTTTTTGTGG - Intronic
1117421627 14:55552245-55552267 CACGCCCGGCTAACTTTTTGTGG + Intergenic
1117682257 14:58216279-58216301 CACACCCAGCTAATTTTTGGGGG + Intronic
1118123464 14:62872534-62872556 CACGCCCAGCTAATTTTTTTTGG - Intronic
1118387263 14:65266230-65266252 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1118432094 14:65729180-65729202 CATGCCCAGCTAATTTTTTATGG + Intronic
1118569806 14:67183000-67183022 CATGCCCAGCTGATGCTATTGGG + Intergenic
1118574683 14:67230413-67230435 CATACCCAGCTTATTTTTTGTGG - Intergenic
1118851882 14:69590363-69590385 CATGCCCAGCTAAATTTTGTGGG + Intergenic
1119281335 14:73411186-73411208 CATGACCGGCTAATTTTTGGGGG + Intronic
1119452048 14:74719983-74720005 CACGCCCGGCTAATTTTTTTTGG - Intronic
1121199407 14:92105257-92105279 CAGGGCCAGGTAATGTTTTTGGG - Intronic
1121202278 14:92128324-92128346 CACGCCCAGCTAATTCTTTTTGG - Intronic
1123685908 15:22797194-22797216 CATGCCCGGCTAATATATTTGGG + Intronic
1123714886 15:23020427-23020449 CATGCCCGGCTAATTTTTTGGGG - Intronic
1123752889 15:23372478-23372500 CAGGCCCAGCTAATCTTTGTGGG + Intergenic
1124108596 15:26764971-26764993 CACACCCAGCTAACTTTTTGTGG - Intronic
1124158079 15:27245714-27245736 CATGCCCAGCTAATTTTTTGTGG - Intronic
1124610286 15:31203376-31203398 CATGCCCAGCCCATATTTTGGGG - Intergenic
1125559028 15:40612332-40612354 CATACCTGGCTAATTTTTTGGGG - Intronic
1125653155 15:41333733-41333755 CACGCCCGGCTAATTTTTTAAGG - Intronic
1125906464 15:43397501-43397523 GATGCCCAGGCCATGTTTTGGGG + Intronic
1126397665 15:48236010-48236032 CATGCCCAGATAAAATTTTAGGG + Intronic
1127656545 15:61061194-61061216 CATGCCCGGCTAATGTTTTGTGG - Intronic
1127696011 15:61448571-61448593 CATGCCCAACTAATTTTTGTAGG + Intergenic
1128890247 15:71325523-71325545 AATGTCCAGCTAATGTTCTAAGG + Intronic
1129083257 15:73060801-73060823 CATGCCCAGCTAATTTTTTTGGG + Intronic
1130138956 15:81207077-81207099 CACGCCTGGCTAATTTTTTGTGG - Intronic
1131104604 15:89724043-89724065 CACGCCCAGCTATTTTTTTTTGG - Intronic
1131536793 15:93244247-93244269 TATGCCCAGATAATATTCTGTGG - Intergenic
1132173516 15:99688598-99688620 CACGCCCGGCTAATTTTTTGTGG - Intronic
1132361480 15:101219921-101219943 CACGCCCGGCTAATTTTGTGAGG + Intronic
1132824186 16:1894927-1894949 CACGCCCAGCTAATTGTTTTTGG + Intergenic
1132827099 16:1910566-1910588 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1133074820 16:3271800-3271822 CATGGCCAGTTAATTTTGTGAGG - Intronic
1133093965 16:3428221-3428243 CATGCCCAGCTAATTTTGTGGGG - Intronic
1133122983 16:3623050-3623072 CATGCCCAGCTAATTTTTTTGGG - Intronic
1133157793 16:3887978-3888000 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1133902775 16:9993071-9993093 CATACCTGGCTAATTTTTTGGGG - Intronic
1134028056 16:10969714-10969736 CATGCCCAGATGTTGTCTTGGGG + Intronic
1134396677 16:13871464-13871486 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1134440595 16:14297514-14297536 CACGCCCGGCTAATTTTTTTTGG - Intergenic
1134491212 16:14696831-14696853 CATGCCCAGCTAATTTTTTGTGG - Intergenic
1134496593 16:14735949-14735971 CATGCCCAGCTAATTTTTTGTGG - Intronic
1135854792 16:25998104-25998126 CATACCTGGCTAATGTTTTAAGG - Intronic
1136129317 16:28209970-28209992 CATGCCTGGCTAATTTTTTGTGG - Intronic
1136353265 16:29726116-29726138 CACGCCCAGCCTATATTTTGAGG + Intergenic
1136430016 16:30191608-30191630 CATGCCCAGCTAATTTTTGGGGG - Intergenic
1137246758 16:46712145-46712167 AATGCCCAACTAATTTTTTTTGG + Intronic
1137416125 16:48282252-48282274 CATGCCCAGCTAATTTTTGTGGG - Intronic
1137521233 16:49197074-49197096 CATTCACAGCTGATGTTCTGTGG + Intergenic
1139508890 16:67415300-67415322 CACGCTCAGCTAATTTTTTAAGG - Intronic
1139519628 16:67473503-67473525 TACGCCCAACTAATTTTTTGTGG + Intronic
1139575496 16:67839401-67839423 CACACCCAGCTAATTTTTTTTGG - Intronic
1139735004 16:68979998-68980020 CATGCCCGGCTAATTTTTTTTGG + Intronic
1139806710 16:69571914-69571936 CACGCCCGGCTAATTTTTTTTGG + Intronic
1139821448 16:69724543-69724565 CACACCCAGCTAATTTTTTTTGG - Intronic
1140047362 16:71450560-71450582 CACACCCGGCTAATTTTTTGTGG - Intronic
1140217260 16:73018448-73018470 AATGCCCAGGTAATTTTTTGTGG - Intronic
1140736525 16:77902814-77902836 CATTCCCAGCTAGGTTTTTGTGG - Intronic
1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG + Intronic
1140913141 16:79471518-79471540 CATGCCCAACTAATTTTTGTGGG - Intergenic
1141106389 16:81237219-81237241 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1141417729 16:83889514-83889536 CATGCCCAGCTAATTTTTATGGG + Intergenic
1141440774 16:84028426-84028448 CATGCCTGGCTAATTTTTTTTGG - Intronic
1141542513 16:84736943-84736965 CTCGCCCGGCTAATTTTTTGTGG + Intronic
1142536138 17:618605-618627 CATGCCCAGCTAATATTTCCCGG + Intronic
1142536166 17:618750-618772 CATGCCCCGCTAATATTTCCCGG + Intronic
1142536236 17:619086-619108 CACGCCCAGCTAATATTTCCCGG + Intronic
1142536294 17:619376-619398 CATGCCCCGCTAATATTTCCCGG + Intronic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1142905424 17:3038080-3038102 CCTGCCCAGCTAATTTTTTAGGG - Intergenic
1143227308 17:5317059-5317081 CATGCCTGGCTAATTTTTGGAGG + Intronic
1143634698 17:8157776-8157798 CATGCCCGGCTAATTTTTGTAGG - Intronic
1143978207 17:10845812-10845834 CATGCCTGGCTAATTTTGTGGGG - Intergenic
1144130032 17:12238024-12238046 CACGCCCAGCTAATTTTTGGGGG - Intergenic
1144526397 17:15994103-15994125 CATGCCCAGCTAATTTTTTTTGG + Intronic
1144865599 17:18333620-18333642 CATGTCCAGCTAATTTTTGTTGG + Intronic
1145237550 17:21219461-21219483 CATGCCCAGCTAACTTTTTTTGG - Intergenic
1145716509 17:27028220-27028242 CATACCCAGCTAATTTTTGTGGG - Intergenic
1145873263 17:28294321-28294343 CATGCCCAACTAATTTTGGGGGG + Intergenic
1145952298 17:28828410-28828432 CATGCCTGGCTAATTTTTTGTGG - Intronic
1146050595 17:29549539-29549561 CATGCCCAGGCAATGTATTTGGG - Exonic
1146206502 17:30909483-30909505 TATGCCCAGCTAATTTTTTTTGG - Intronic
1146999393 17:37350361-37350383 CACACCCAGCTAATTTTTTCTGG - Intronic
1147499465 17:40948848-40948870 CATGCCCAGCTAATTTTTGTGGG - Intergenic
1147719506 17:42530042-42530064 CATGCCCGGCTAATTTTTGCAGG - Intergenic
1147869308 17:43576459-43576481 CATGCCCTGCTAATTTTTGCAGG + Intronic
1148009184 17:44461845-44461867 CAAGCCCAACTAATTTTTGGGGG + Intronic
1148220374 17:45857336-45857358 CATGTCCAGCCAATTTTCTGGGG + Intergenic
1148542887 17:48493908-48493930 CATGCCCAGCTAATCGGGTGCGG - Intergenic
1149031183 17:52084361-52084383 CATGCTCAGCAAATGCTGTGTGG - Intronic
1149483079 17:57018962-57018984 CACGCCCGGCTAATATTTTGAGG + Intergenic
1149489810 17:57076113-57076135 CATTCACAGGCAATGTTTTGTGG + Intergenic
1149587703 17:57803890-57803912 CACGCCCAGCTAATTTTTTTGGG + Intergenic
1149676794 17:58472008-58472030 CATGCCTGGCTAATTTTTTTTGG + Intronic
1149748010 17:59118107-59118129 AATGCCCAGCTAATTTTTTGTGG - Intronic
1149790770 17:59474917-59474939 CATGCCCAGCTAATTTTTCTGGG + Intergenic
1150555676 17:66252095-66252117 CATGCCCAGCTAATTTTTGTAGG - Intronic
1151230433 17:72681097-72681119 CATGCCCAGGTAATTTTTTTGGG + Intronic
1151278915 17:73057105-73057127 CATGCCCAGTTAATTTTTTGTGG + Intronic
1151308305 17:73278124-73278146 CACGCCCAGCTAATTTTAAGCGG + Intergenic
1151597889 17:75088886-75088908 CAAGCCCAGCCTATGTTTTCAGG - Intronic
1151731091 17:75911673-75911695 CACGCTCAGCTATTTTTTTGTGG + Intronic
1151735314 17:75936333-75936355 CAGGCCCAGCTAATTTTGGGGGG - Intronic
1152156967 17:78640767-78640789 CATGCCAAGCTAATTTTTTTTGG - Intergenic
1153367478 18:4273597-4273619 AATGCCTGGCTAATTTTTTGTGG + Intronic
1153437545 18:5083880-5083902 GAGGCCCAGCTTAAGTTTTGTGG - Intergenic
1153671838 18:7419180-7419202 CATGCCCAGCTAATTTCTTTTGG + Intergenic
1153763544 18:8354054-8354076 CACGCCCAGCTAATTTTTTGTGG - Intronic
1154118538 18:11633069-11633091 CAGGCCCAACTAATCTTTTTTGG + Intergenic
1154974883 18:21447851-21447873 CATTCCCAGCAAGTTTTTTGAGG + Intronic
1155142357 18:23054755-23054777 CACGCCCAGCTAATTTTTATGGG + Intergenic
1155352483 18:24920070-24920092 CACACCCAGCTAATTTTGTGGGG - Intergenic
1155482835 18:26308095-26308117 CATGCCCAACTAATTTTGGGGGG - Intronic
1155574940 18:27234399-27234421 AACACCCAGCTAATTTTTTGTGG + Intergenic
1155647413 18:28095651-28095673 CATGCACAGCTAATTTTTAGTGG - Intronic
1156243352 18:35274170-35274192 CATGCCCAGCTAATTTTTGGGGG + Intronic
1156409052 18:36810480-36810502 CATGCCCAGGCTATATTTTGGGG + Intronic
1156727456 18:40146798-40146820 CATGCCTGGCTAATTTTTTTAGG + Intergenic
1157931856 18:51832302-51832324 TACGCCCGGCTAATTTTTTGTGG - Intergenic
1157974631 18:52313159-52313181 CAGGCCCAGCCACTGTTTGGTGG + Intergenic
1158525830 18:58212633-58212655 CATGCCTAGCCAATTTTTTGTGG + Intronic
1158690334 18:59654633-59654655 CATGCCCGGCTAATTTTGTTTGG - Intronic
1158800941 18:60908016-60908038 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1158970159 18:62658774-62658796 CACACCCAGCTAATTTTTTGAGG - Intergenic
1159191028 18:65042894-65042916 CACGTCCAGCTAATTTTTTGGGG + Intergenic
1159347425 18:67225249-67225271 CATGCCCAGCTAATTTTTGTGGG + Intergenic
1159546815 18:69849812-69849834 AATGCCCAGCTAATATTTAAAGG - Intronic
1160204201 18:76820311-76820333 TATGCCTAGCTAATTTTTTGTGG - Intronic
1160301382 18:77683373-77683395 AATGTTCTGCTAATGTTTTGGGG + Intergenic
1160456424 18:79005603-79005625 CACACCCTGCTAATTTTTTGGGG + Intergenic
1160882732 19:1329196-1329218 CATGCCCAGCTAATTTTTCTAGG - Intergenic
1160973022 19:1778253-1778275 CATGCCCATTTAATTTTTTAAGG + Exonic
1161477541 19:4494759-4494781 CACGCCCAGCTAATTTTTTAAGG - Intronic
1161529370 19:4778064-4778086 CACGCCTGGCTAATTTTTTGGGG + Intergenic
1162266352 19:9578235-9578257 CATGTCTGGCTAATTTTTTGAGG - Intronic
1162460943 19:10813667-10813689 CATGCCCAGCTAATTTTTTTTGG - Intronic
1162648480 19:12067041-12067063 CACACCCAGCTAATTTTTTATGG - Intronic
1162653226 19:12107618-12107640 CATGCCCAGCTAATTTTTGTGGG - Intronic
1162662528 19:12181627-12181649 CACGCCCAGCTAATTTTTTTTGG + Intronic
1163500419 19:17672906-17672928 CATCCCCATCTAATGATGTGAGG + Intronic
1163573285 19:18096069-18096091 CATGCCTGGCTAATTTTTTTGGG - Intronic
1163680630 19:18680080-18680102 CATGCCTGGCTAATGTTTTGTGG - Intergenic
1164256016 19:23528909-23528931 CAAGCCCAGCTAATTTTTTTAGG - Intronic
1164275788 19:23716672-23716694 CACGCCCAGTTAATTTTTTGTGG - Intergenic
1165129999 19:33625927-33625949 CATGCCCAGCCAACTTTCTGAGG - Intronic
1165165741 19:33854252-33854274 CATGCCCGGCTAATTTTTCATGG - Intergenic
1165430962 19:35772460-35772482 CAGGCCCAGCTAATTTTTAGTGG - Intergenic
1165491114 19:36123415-36123437 CACCCCCGGCTAAAGTTTTGTGG + Intronic
1165812787 19:38622060-38622082 CATGCCCAGCTAATTTTACTTGG + Intronic
1165822946 19:38688412-38688434 CATGTCCAGCTAATTTTTGTGGG - Intronic
1166577193 19:43853316-43853338 CACGCCTGGCTAATGTTTTTGGG - Intergenic
1167062843 19:47161160-47161182 CATGCTCTGCTAATTTTTTCGGG + Intronic
1167082894 19:47289435-47289457 CGTGCCCGGCTAATGTTTTGTGG + Intergenic
1167434206 19:49469729-49469751 CATGCCCAGCTAATTGTTGGGGG + Intronic
1167750571 19:51377185-51377207 CACTCCCAGCTAATTTTTTGGGG - Intergenic
1168045412 19:53790767-53790789 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1168223049 19:54974954-54974976 CAGGCCCGGCTAATTTTTTGTGG + Intronic
1168260796 19:55193272-55193294 CATGCCCAGCTATTTTGTTGGGG - Intronic
1168428162 19:56256347-56256369 CACACCCGGCTAATCTTTTGTGG + Intronic
1168624067 19:57902815-57902837 CATGCCCGGCTAATTTTTTGTGG + Intronic
925236236 2:2280251-2280273 AATGCCTAACTAGTGTTTTGTGG - Intronic
925246913 2:2391773-2391795 TATGCCCAGCTATTTGTTTGTGG - Intergenic
925536769 2:4926541-4926563 CATGCCCGGCTAATGTTTTTTGG + Intergenic
925585484 2:5460444-5460466 CATGCCTGGCTAATGTTTTTAGG + Intergenic
926725521 2:15994495-15994517 CAAGCCCGGCTAATTTTGTGGGG + Intergenic
927034177 2:19155801-19155823 CAGGCCCAGCTAATTTTTCTAGG - Intergenic
927733959 2:25501534-25501556 CATGCCCAGCTAATTTTTGTTGG + Intronic
927941828 2:27108937-27108959 CATGCCCAGCTTTTTTTTTTTGG + Intronic
928019432 2:27690641-27690663 AATGCCCAGCTAATTTTTGTGGG + Intronic
928966749 2:36983569-36983591 CACACCCAGCTAATATTTTTGGG - Intronic
928989174 2:37213566-37213588 CATGCCCAGCTCATTTTTTGGGG + Intronic
929475680 2:42245249-42245271 CATGCCTGGCTAATTTTTTGTGG + Intronic
929512074 2:42572420-42572442 CATGCCCGGCTATTTTTTTTTGG - Intronic
930168818 2:48230675-48230697 AATGCCCAGATAATTTTTTAGGG - Intergenic
931270006 2:60693275-60693297 CACGCCCGGCTAATTTTTTTTGG - Intergenic
931329665 2:61267597-61267619 TACACCCAGCTAATTTTTTGTGG + Intronic
931670685 2:64644231-64644253 CATGCCCAGCTAATTTTACCAGG - Intronic
931672889 2:64664823-64664845 CATGCCCAGCTAATTTTTATGGG + Intronic
931725975 2:65111068-65111090 CATGCCTGGCCAATATTTTGAGG - Intronic
931766590 2:65462241-65462263 CATGCCCAGCTAGGTTTTTTTGG - Intergenic
932072892 2:68638361-68638383 TATGCCCAGCTAAGTTTTTCAGG - Intergenic
933119936 2:78523835-78523857 CATGCCAAGCTAATTTTTTTGGG - Intergenic
933169994 2:79114527-79114549 CATGCCCAGCTAATTTTTGACGG + Intergenic
933712831 2:85340181-85340203 CATGCCCAGCTAATTTTTCTGGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934646549 2:96062326-96062348 CATGCCCAGCTTACAGTTTGAGG - Intergenic
934866065 2:97812845-97812867 CATGCCCAGCTAATTTTGGGGGG - Intronic
935159195 2:100514589-100514611 CATGCCTAGCTAATTTTTTGGGG + Intergenic
935858624 2:107302659-107302681 CACACCCAGCTAATTTTTTTTGG - Intergenic
936843233 2:116799594-116799616 CAGGTTCAGCTAATTTTTTGTGG + Intergenic
936885033 2:117300050-117300072 GATGCCCAGGTACTGTATTGAGG + Intergenic
937108012 2:119337209-119337231 CATGCCCAGCTAGTTTTTTGGGG + Intronic
937386687 2:121440533-121440555 CATGCCCTGCTAATTTTTTGTGG - Intronic
937963636 2:127484010-127484032 CATGCCCGGCTAACAATTTGAGG - Intronic
937972630 2:127562451-127562473 CACGCCCAGCTAATTTTTGTGGG + Intronic
938272289 2:129983720-129983742 CACGCCCAGCTAATTTTTGTAGG - Intergenic
938290798 2:130149147-130149169 CATGCCCATCTGAGGTTTTTGGG + Intergenic
938465751 2:131523806-131523828 CATGCCCATCTGAGGTTTTCGGG - Intergenic
938821023 2:134960324-134960346 CATGCCCGGCTAATTTTGGGGGG + Intergenic
938838812 2:135137980-135138002 CATGCCTGGCTAATTTTTCGTGG + Intronic
938909255 2:135870902-135870924 CATGCCCAGCTAATTTTTGTGGG + Intronic
939612258 2:144325973-144325995 CAATCCCAGTTATTGTTTTGAGG - Intronic
939924712 2:148158874-148158896 CATGCCTGGCTAATTTTTTTTGG + Intronic
940882728 2:158962638-158962660 CACGCCCAGCTAATTTTTATTGG - Intergenic
942135527 2:172921251-172921273 CATGCCCAGCTAGTTTTTTGTGG + Intronic
942234966 2:173895137-173895159 CATGCCCAGCTAATTTCTTGGGG + Intergenic
942647410 2:178128160-178128182 CATGCCCAGGTAATTTTTTTTGG + Intronic
942977648 2:182038192-182038214 CATGACCAGCTAATGTTTTGTGG + Intronic
943314340 2:186368160-186368182 CATTCTCTTCTAATGTTTTGAGG + Intergenic
943673896 2:190697649-190697671 CATGCTCAGCTAATATTTTAAGG + Intergenic
944544953 2:200790071-200790093 CATGCCTGGCTAATTTTTTTGGG - Intergenic
944626858 2:201579395-201579417 CATGCCTGGCTAATTTTTTGTGG + Intronic
944742237 2:202623843-202623865 CATGCCCGGCTAATTTTTAGTGG - Intergenic
944831763 2:203540135-203540157 CACGCCTGGCTAATTTTTTGTGG + Intergenic
945266782 2:207898599-207898621 CATGCCCAGCTAATTTTTGTGGG - Intronic
945351237 2:208783335-208783357 CAACCCCAGCTAATGTGTTGTGG - Intronic
945777978 2:214131210-214131232 TATGCCCAGCTACTTTTTTTTGG - Intronic
945949014 2:216021302-216021324 CACACCCAGCTAATATTTTGGGG + Intronic
945958408 2:216107470-216107492 CAAGCCCAGCTAATTTTTGTGGG - Exonic
946288575 2:218725374-218725396 CATGCCTAGCTAATTTTTTATGG + Intronic
946301263 2:218825489-218825511 CACGCCCAGCTAATTTTTGGGGG - Intronic
946854637 2:223940797-223940819 CATGCCCAGCTAATTTTTGTGGG + Intronic
946906609 2:224422846-224422868 CATGCCCAGCTAATTTTTTGGGG - Intergenic
947881342 2:233516529-233516551 CAGGCCCGGCTAATTTTTAGTGG - Intronic
948436865 2:237959728-237959750 TGCGCCCAGCTAATTTTTTGTGG - Intergenic
948438631 2:237970863-237970885 CATGCCGAGCTAATTTTTTTTGG + Intronic
948900109 2:240952188-240952210 CATGCCCGGCTAATTTTTTGTGG - Intronic
1168862247 20:1053952-1053974 CACGCCCAGCTAATTTTGTATGG - Intergenic
1169001423 20:2170695-2170717 CATGCCCAGCTAATGCCAAGAGG - Intronic
1169025592 20:2368467-2368489 AATTCCCAGCTGATGTTCTGGGG + Intergenic
1169067504 20:2702269-2702291 CATGCCCAGCTAATTAATTTTGG - Intronic
1169071400 20:2734250-2734272 CATGCCCAGCTAATTTTTGTAGG - Intronic
1169076705 20:2764443-2764465 CACACCCAGCTAATTTTTTAGGG + Intergenic
1169107068 20:3005391-3005413 CATGCCTGGCTAATTTTTTAAGG - Intronic
1169181753 20:3575118-3575140 TATGCCCAGCTAATTTTTCTAGG + Intronic
1169223582 20:3841726-3841748 CATGCCCGGCTAATTTTTGTGGG - Intergenic
1169338528 20:4777222-4777244 CATGCCCAGCTAATTTTGGGGGG + Intergenic
1170983575 20:21237984-21238006 CATGCCTGGCTAATTTTTTGTGG + Intronic
1172043603 20:32063407-32063429 CATGCCTGGCTAATTTTTTTGGG + Intronic
1172248147 20:33460227-33460249 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1172373324 20:34414621-34414643 CACGCCCAGCTAATTTTGTGGGG + Intronic
1172609946 20:36243012-36243034 CACGCCCAGCTAATTATTTTTGG + Intronic
1172697092 20:36830409-36830431 CATGCCAAGCTAACTTTTTTGGG - Intronic
1172710793 20:36921678-36921700 CACACCCAGCTAATTTTTTGTGG + Intronic
1172912423 20:38419891-38419913 CGTGCCTGGCTAATTTTTTGTGG + Intergenic
1173203557 20:40972417-40972439 CATGCCCAGCTTATTTTTTAAGG + Intergenic
1173347874 20:42217452-42217474 TATGCCCATCTACAGTTTTGGGG - Intronic
1173380394 20:42534477-42534499 CATGCCCGGCTAAATTTTTTTGG - Intronic
1173482983 20:43417502-43417524 CATGCCCAGCTAATTTTTGCTGG + Intergenic
1173516925 20:43671123-43671145 CATGCCCAGCTAATTTTTGTGGG + Intronic
1173614647 20:44394825-44394847 CATGCCCAGTTAATTTTTTAAGG + Intronic
1173679778 20:44869861-44869883 AAGGCCCAGCTAATTTTTTGTGG - Intergenic
1173781183 20:45758733-45758755 CAAGCCCAGCTAATTTTTGTGGG + Intronic
1174009987 20:47442003-47442025 CATGCCCAGCTAACTTTTTTAGG + Intergenic
1174016333 20:47491334-47491356 CATGCCCGGCTAATTTTTGTAGG + Intergenic
1174214266 20:48904079-48904101 CATGCCCAACTAATTTTTTTTGG - Intergenic
1174486981 20:50867501-50867523 CATGCCCAGCTAATTTTTTTGGG + Intronic
1174596162 20:51685403-51685425 CACGCCCAGCTAACTTTTTTTGG - Intronic
1174641365 20:52047282-52047304 CATGCCCAGCTAATTTTTGGTGG + Intergenic
1174841895 20:53908914-53908936 CATGCCCAGCATATTTTTTGTGG - Intergenic
1175058099 20:56216509-56216531 CATGCCCAGCTAATTGTTTGGGG - Intergenic
1176519560 21:7814363-7814385 CATGCCCAGGTAATTTTTTCTGG - Intergenic
1177540262 21:22483831-22483853 AATGCCCAGGTGATGTGTTGAGG - Intergenic
1178362798 21:31963651-31963673 CATGCCCAGCTAATTTTTTTTGG + Intronic
1178418150 21:32420540-32420562 CAGGCCTAGCTAATTTTTTTTGG + Intronic
1178653588 21:34444376-34444398 CATGCCCAGGTAATTTTTTCTGG - Intergenic
1179788452 21:43742334-43742356 CATGCCCAGCTAACTTTTTGTGG + Intronic
1180687116 22:17677887-17677909 CATGCCCAGCTAATTTTTGTGGG - Intronic
1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG + Intergenic
1181347750 22:22232444-22232466 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1181536082 22:23546159-23546181 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1181806428 22:25377214-25377236 TATGCCCAGCTAATTTTTGGTGG + Intronic
1182159773 22:28109993-28110015 AATGCCCAGCTAATGTCTGCTGG - Intronic
1182386974 22:29952043-29952065 CACGCCCAGCTAATTTTTGTGGG + Intronic
1182427355 22:30281743-30281765 CATGCCCAGCTAATTATTTTTGG + Intergenic
1182577150 22:31280711-31280733 CATGCCCAGCCATTGCTCTGTGG - Intergenic
1182634891 22:31718226-31718248 CCCGCCCAGCTAATTTTTTGGGG + Intronic
1182760221 22:32716685-32716707 CATACCCGGCTAATTTTTTGTGG + Intronic
1182874695 22:33681247-33681269 CATCCCCTGCAAATGTTTTGGGG - Intronic
1183132681 22:35854428-35854450 CATACCCAGCTAATTTTTTTGGG - Intronic
1183214209 22:36468568-36468590 CATGCCTGGCTAATATTTTGGGG - Intronic
1183851491 22:40592643-40592665 CATGCCTGGCTAATTTTTTTTGG + Intronic
1184540931 22:45124128-45124150 CATGCCTGGCTAATATTTTTAGG + Intergenic
949238133 3:1836118-1836140 CATGCTCAGCTAACTTTTTTTGG + Intergenic
950971890 3:17197531-17197553 CAAGCCCAGCTAATTTTTTTTGG + Intronic
951333618 3:21394804-21394826 CACACCGAGCTAATTTTTTGTGG + Intergenic
951667822 3:25146659-25146681 CGCGCCCGGCTAATTTTTTGTGG + Intergenic
952315717 3:32230550-32230572 CATGTCCGGCTAATTTTTTGGGG + Intergenic
952456726 3:33479496-33479518 CACACCCAGCTAATTTTTTGAGG + Intergenic
952654229 3:35764693-35764715 CAAGCCTAGATAATGTTTTGTGG + Intronic
953163332 3:40442454-40442476 CATGCCTGGCTAATTTTTTTGGG - Intergenic
953775241 3:45811061-45811083 CATGCCCAGCTAATTTTTACAGG - Intergenic
953801457 3:46027035-46027057 CACACCTAGCTAATTTTTTGGGG + Intronic
953865981 3:46583904-46583926 CATGCCCGGCTAACTTTTTGGGG + Intronic
954241997 3:49301094-49301116 CATGCCTGGCTAATTTTTTTAGG + Intronic
954669843 3:52284328-52284350 CATGCCTGGCTAATTTTTTGTGG - Intronic
954737093 3:52715541-52715563 CAGGCCCAGCTAATTTTTTTTGG + Intronic
954835842 3:53467224-53467246 CAGCCCCAGCTAATTTTTTATGG - Intergenic
954883846 3:53854958-53854980 CACGCCCGGCTAATTTTTTGTGG - Intronic
954945882 3:54424043-54424065 CATGACATGCTAATGTTTTCCGG + Intronic
955244942 3:57216453-57216475 CAGGCCTGGCTAATTTTTTGTGG - Intronic
955672038 3:61412171-61412193 CATGCCCAGCTAATTTTTTTTGG - Intergenic
956462847 3:69488734-69488756 CATGCCCAGCTAATTTTTAGTGG - Intronic
957131528 3:76228853-76228875 CATGCCCCACTAATTTTTTAAGG - Intronic
957450024 3:80367965-80367987 CATGCTTACCTAATGTTTTCAGG + Intergenic
957546903 3:81650819-81650841 CATGCTCAGCTAATTTTGGGGGG + Intronic
959538382 3:107512705-107512727 CACGCCCAGCCAATTTTTTTTGG - Intergenic
959748670 3:109807696-109807718 CACACCCAGCTAATTTTTTTTGG - Intergenic
960635181 3:119777900-119777922 CATGCCCAGCTATTTTTTTCTGG - Intergenic
960823217 3:121756495-121756517 CATGCCCAGCTAATTTTTGTGGG + Intergenic
960985168 3:123274378-123274400 CACGCCCAGCTTATTTTTTTTGG - Intergenic
961845881 3:129762623-129762645 CAAGCCCAGCTAATTTTTTTTGG - Intronic
962573596 3:136735767-136735789 CACGCCCAGCTAATTTTTTCTGG + Intronic
962578724 3:136778083-136778105 CATGCCCAGCTAATTTTTTGTGG - Intergenic
962607704 3:137046063-137046085 CATGCCCAGCTAATTTTTGCAGG - Intergenic
962771698 3:138616529-138616551 CACACCCAGCTAATTTTTTTTGG + Intronic
963129705 3:141846991-141847013 CATGCCCGGCTAATTTTTGTGGG + Intergenic
963302620 3:143616035-143616057 CACGCCCAGCTAATTTTTTTTGG + Intronic
963306573 3:143660083-143660105 CAAGACCAGCTAATGTTTAAAGG - Intronic
963716097 3:148805538-148805560 CACGCCCGGCTAATTTTTTGTGG - Intronic
963894787 3:150673743-150673765 CACGCCCAGCTAACACTTTGTGG + Intronic
964341760 3:155715767-155715789 CATGCCCAGCTAATTTTTTGTGG + Intronic
964721575 3:159772308-159772330 CATGCCCAACTAACTTTTTAGGG + Intronic
966178484 3:177165931-177165953 CATGTCCAGCTAATTTTTTGTGG - Intronic
966408301 3:179622122-179622144 CATGCCCAACTAATTGTTTAGGG + Intronic
966519603 3:180858606-180858628 CATGCACAGATAATATTCTGTGG - Intronic
966547223 3:181163320-181163342 TACGCCCAGCTAATTTTTGGTGG - Intergenic
967200893 3:187071602-187071624 CACGCCCGGCTAATTTTTTGGGG - Intronic
967340735 3:188394603-188394625 TATACTCAGCTAATGTTCTGGGG - Intronic
967559733 3:190904047-190904069 CTTGCCCAGGGAATGTTTTGTGG + Intergenic
967960934 3:194923435-194923457 CATGACCAGCTAATTTTTTGTGG + Intergenic
968053146 3:195670008-195670030 CATGCCCAGCTAATTTTTGAGGG + Intergenic
968102667 3:195978353-195978375 CATGCCCAGCTAATTTTTGAGGG - Intergenic
968168302 3:196486902-196486924 CATGCCTGGCTACTTTTTTGTGG - Intronic
968277230 3:197449634-197449656 CACGACCAGCTAATTTTTTATGG - Intergenic
968320934 3:197767619-197767641 TATGCCCAACTAATTTTTAGAGG + Intronic
968775996 4:2540488-2540510 CACGCCTGGCTAATTTTTTGGGG - Intronic
969071912 4:4546547-4546569 CATGCCCAGCTAATTTTTTGGGG + Intergenic
970501857 4:16685893-16685915 CATGCCCAACTACTTTTTTTTGG - Intronic
970774502 4:19656718-19656740 CATGCCCGGCTAATTTTTTTTGG - Intergenic
970885976 4:20987842-20987864 CACGCCCGGCTAATTTTTTTTGG - Intronic
971360746 4:25936349-25936371 CATGCCCAGCTAACTTTTTTTGG - Intergenic
972334695 4:38097317-38097339 CATGCCTGGCTAATTTTTTGTGG + Intronic
972441622 4:39099129-39099151 CATGCCTGGCTAATTTTTTTTGG - Intronic
972463499 4:39329337-39329359 CCTCCCCAGCTAATTTTTTTTGG - Intronic
972657115 4:41074982-41075004 CGTGGCCAGATAATTTTTTGTGG - Intronic
973991442 4:56412464-56412486 CATGCCTGGCTAATTTTTTGTGG + Intronic
975464118 4:74689983-74690005 CAAGCCCAGCTAATTTATTTTGG + Intergenic
975473692 4:74797637-74797659 CACACCCAGCTAATTTTTTGTGG + Intergenic
975540052 4:75499982-75500004 CATGCCCAGCTAATTTTTTGTGG - Intronic
975701125 4:77067645-77067667 CAAGCCCAGGTAATTTTGTGGGG + Intronic
976775536 4:88701957-88701979 CAGGCCTGGCTAATTTTTTGTGG + Intronic
976779973 4:88748044-88748066 CACGCCCGGCTAATTTTTTTTGG + Intronic
977196447 4:94067065-94067087 CATGCCCAGCTAATTTTTGTGGG + Intergenic
977639471 4:99340255-99340277 TGTGCCCAGCTAATTTTTTTGGG - Intronic
978528157 4:109687200-109687222 CATGCCCACCTAATATTTTTTGG - Intronic
980306087 4:131063634-131063656 CTTGCTCAGCTAATCTTTTCAGG - Intergenic
980486378 4:133462307-133462329 CCTGCCCTGCTTATGTTTTGAGG - Intergenic
980516515 4:133869157-133869179 CACGTCCAGCTAATGTTTTGGGG - Intergenic
981294883 4:143120351-143120373 CATGCCTGGCTAATTTTTAGTGG - Intergenic
981427137 4:144616543-144616565 CCTGCCCAGCTACTTTGTTGTGG - Intergenic
981601334 4:146492061-146492083 CACGCCCAGCTAATTTTTTTTGG - Intronic
981916561 4:150040262-150040284 CATGCATAGCTACTGTTATGTGG - Intergenic
981998756 4:151002855-151002877 TACACCCAGCTAATTTTTTGGGG - Intronic
983304151 4:165964778-165964800 CATGCCCAGCTAATTGTTGTTGG - Intronic
983467668 4:168115041-168115063 CATGCCCAGCTAATTTTGTATGG + Intronic
983474543 4:168197616-168197638 CATGCCCAGCTAATTTTTTTTGG - Intergenic
984083932 4:175284905-175284927 TATGCCCAGCTAATTTTTGATGG + Intergenic
984329734 4:178299020-178299042 CATGCCCAGCTAATTTTTGTGGG - Intergenic
984559810 4:181254974-181254996 CATGCCCAGCTAAGGGTTTAGGG + Intergenic
984769926 4:183428441-183428463 CATGCCCAGCTAATTTTTCTGGG - Intergenic
985499399 5:232365-232387 CATGCCCAGCTAATTTTCGAGGG + Intronic
986424434 5:7616532-7616554 AATGCTCAGCAAATGTTTTGTGG + Intronic
987649239 5:20719259-20719281 TATGCTCAGCTAATTTTTTGTGG + Intergenic
987939989 5:24521448-24521470 CATGCCCACCTAATTTTGTAAGG - Intronic
987943388 5:24571842-24571864 CATGCCCAGCTGAGGTCATGGGG - Intronic
987985667 5:25142285-25142307 CACGCCCAGCTAATTTTTAGTGG + Intergenic
988654781 5:33197884-33197906 CATGCCCAGCTGATTTTGTGAGG - Intergenic
988746321 5:34142273-34142295 TATGCTCAGCTAATTTTTTGTGG - Intergenic
989011909 5:36881428-36881450 CATTGCCAGCTAAGATTTTGAGG + Intronic
989018308 5:36967938-36967960 CTTGCCTGGCTAATTTTTTGTGG - Intronic
989661574 5:43804471-43804493 CTTGCTCAGCTAATGTTATTGGG - Intergenic
990169586 5:53033110-53033132 CACGCCCTGCTAATTTTTTATGG - Intronic
991457480 5:66819928-66819950 CATACCCAGCTAATTTTTGTGGG + Intronic
991481221 5:67082303-67082325 CACGCCCAGCTAATTTTTGTTGG + Intronic
992081418 5:73236872-73236894 CATGCCCGGCTAATTTTTGTGGG - Intergenic
992666786 5:79018202-79018224 CATGCCCGGCTAATTTTTTGTGG + Intronic
992740221 5:79766253-79766275 CAAGCCCCGCTAATTTTTTTGGG + Intronic
993173498 5:84451981-84452003 CATGCCCGGCTAATTTCTTTTGG - Intergenic
993611263 5:90057457-90057479 CATTCCTAGCTAATTTTTTCTGG - Intergenic
993649407 5:90500487-90500509 CATTCTTAGCTAATGTTTTTTGG + Intronic
994433761 5:99702227-99702249 CATGCCCAGATAATTTTTTTTGG + Intergenic
994588935 5:101749166-101749188 TATGCTCAGCTAATATTTAGGGG + Intergenic
994697615 5:103092171-103092193 CATGCCCGGCTAATTTTTGTAGG + Intronic
995517180 5:112965905-112965927 CATGCCTAGCTAATCTTTTTGGG + Intergenic
995680841 5:114717792-114717814 CAGGCCCAGCTACTTTTTTTTGG - Intergenic
996071919 5:119140738-119140760 CCTCCCCAACTAATTTTTTGAGG + Intronic
996638697 5:125727742-125727764 CATGCCCAGCAAATTTTTTGTGG + Intergenic
996847074 5:127911862-127911884 CATGCCCAGATAATTGTTTTTGG + Intergenic
997329015 5:133045655-133045677 CATGCCCAGCTAATTTTTTTGGG - Intergenic
997411490 5:133694420-133694442 CATGCTCAGTTAATGTTTTGTGG - Intergenic
997903750 5:137793770-137793792 CATGCCTGGCTAAGTTTTTGTGG + Intergenic
997948823 5:138225545-138225567 CAAGCCCAGATAATTTTTTGAGG + Intergenic
997971020 5:138402083-138402105 CGTGCCCAGCTAATTTTTTTTGG + Intronic
997971323 5:138404879-138404901 CATGCCCTGCTAATTTTTGTGGG + Intronic
998032202 5:138880300-138880322 CATGCCTGGCTAATTTTTTGTGG + Intronic
998087174 5:139336041-139336063 CATGCCCAGCTAATTTTTGTAGG + Intergenic
998785602 5:145705345-145705367 TATGCCCAGCTAATTTTTGTGGG + Intronic
999061329 5:148638888-148638910 CACGCCCATCTAATTTTTTGTGG - Intronic
999458468 5:151737522-151737544 CATGCCCAGCTAATTTGTCCTGG + Intergenic
999727668 5:154450117-154450139 AATGCCCAGCAAATGACTTGGGG - Intronic
999754883 5:154656940-154656962 CACACCCAGCTAATTTTTTTTGG - Intergenic
999831100 5:155320998-155321020 CATGCCCAGCTAATTTTTTGTGG + Intergenic
1000092426 5:157941244-157941266 CACGCCCAGCTAATTTTTGTGGG + Intergenic
1000170101 5:158693987-158694009 CACGCCCAGCTAATTTTTTTTGG + Intergenic
1000311833 5:160052337-160052359 CATGCCTGACTAATTTTTTGTGG - Intronic
1000613768 5:163405469-163405491 CATGCCCACCTAATTATTTTTGG + Intergenic
1000652410 5:163833408-163833430 CATGTCCGGCTAATTTTTTTTGG - Intergenic
1000896200 5:166858452-166858474 CAGGCCCAGCTATTTTTTTTGGG - Intergenic
1001305324 5:170568254-170568276 CATGCCCAGGAAATGTTTGCTGG - Intronic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1002015531 5:176318950-176318972 TAAGCCCAGCTAATTTTTTGTGG - Intronic
1002162737 5:177325630-177325652 CATGCCCAGCTAGTTTTTGGCGG - Intergenic
1002220717 5:177678533-177678555 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1002392240 5:178924214-178924236 CATGCCCGGCTAATTTTTTGTGG - Intronic
1002678631 5:180940934-180940956 CAAGCCCAGCTAATTTTTATGGG - Intronic
1003608124 6:7584062-7584084 AATGCCAAGCTTCTGTTTTGTGG - Exonic
1004313663 6:14567513-14567535 CACGCCCAGCTAATTTTTTTCGG - Intergenic
1004420759 6:15467677-15467699 CACACCCAGCTAATTTTTTGTGG - Intronic
1004513173 6:16298952-16298974 CCTTCGCTGCTAATGTTTTGGGG - Intergenic
1004896243 6:20150718-20150740 TACGCCCAGCTAATTTTTTTTGG + Intronic
1005326781 6:24709748-24709770 CATGCCCAACAGATATTTTGTGG - Intronic
1005432752 6:25775590-25775612 CATGCCTGGCTAATTTTTTGTGG + Intronic
1005437357 6:25829105-25829127 AAGGCCCAACTTATGTTTTGAGG - Intronic
1005477553 6:26222658-26222680 CATGCCCGGCTTATTTTTTTGGG - Intergenic
1005544469 6:26850506-26850528 TACGCTCAGCTAATTTTTTGTGG - Intergenic
1005682854 6:28224349-28224371 CATGCCCAGCATTTTTTTTGGGG - Intergenic
1005731949 6:28706250-28706272 CATGCCCAGCTAATTAATTTTGG + Intergenic
1007040404 6:38716113-38716135 CACGCCCGGCTAATTTTTTTTGG + Intronic
1007153950 6:39724294-39724316 CACGCCCGGTTAATTTTTTGTGG - Intronic
1007508050 6:42352157-42352179 CATGCCTGGCTAATTTTTTATGG + Intronic
1007532252 6:42553506-42553528 CATGCTCCGCTAATTTTTTAAGG + Intergenic
1007573396 6:42909428-42909450 CGTGCCCAGCTAATTTTTTTTGG + Intergenic
1007646326 6:43384377-43384399 CATGCCTGGCTAATTTTTTTGGG + Intergenic
1007654227 6:43442571-43442593 CAAGCCCAGCTAAATTTTTTTGG - Intronic
1007760482 6:44130594-44130616 CATGCCCAGCTAAATTTTGGTGG + Intronic
1007883390 6:45193557-45193579 CATGCCCAGCTAATTTTTTGAGG - Intronic
1010041474 6:71389920-71389942 CATGCCTGGCTAATTTTTTGTGG - Intergenic
1010652031 6:78467123-78467145 CATGCCATTCTAATTTTTTGGGG - Intergenic
1011433756 6:87315637-87315659 TATGCCCTGCTAATTTTTTTTGG - Intronic
1011566133 6:88674381-88674403 CATGCCTGGCTAATTTTTTGTGG - Intronic
1011605077 6:89095367-89095389 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1011741164 6:90362103-90362125 CACACCCAGCTAATTTTTTGGGG - Intergenic
1012421409 6:99069961-99069983 TATGCTCAGCTAATTTGTTGGGG + Intergenic
1013090903 6:106900106-106900128 CATGCCCAGCTAATTTCTGTAGG + Intergenic
1014156755 6:118119658-118119680 CATGCCCAGCTAATTTCTGTAGG + Intronic
1014189965 6:118484157-118484179 CACGCCCAGCTAATTTTTTTGGG - Intronic
1014747889 6:125221252-125221274 CAGACCCAGCTAAAGATTTGAGG - Intronic
1014770707 6:125454924-125454946 CAGGGCCAGTTGATGTTTTGGGG - Intergenic
1015123924 6:129731211-129731233 CTCTCCCTGCTAATGTTTTGAGG - Intergenic
1015446471 6:133311480-133311502 CATGCCTGGCTAATTTTTTGTGG + Intronic
1015596008 6:134867755-134867777 CATGCCCGGCTAATTTTTGGAGG + Intergenic
1015653557 6:135491633-135491655 CATCCCCAGCTACTATTATGAGG + Intronic
1015801925 6:137069191-137069213 CATGCCTGGCTAATTTTTGGGGG + Intergenic
1016318665 6:142818510-142818532 CACGCCTGGCTAATTTTTTGTGG - Intronic
1016671296 6:146711898-146711920 CATGCCTGACTAATGTTTTTGGG - Intronic
1016946744 6:149541855-149541877 CATGCCTGGCTAATTTTTTTTGG - Intronic
1016961993 6:149682566-149682588 CATGCCCAGCTAATTTTTTTTGG + Intronic
1017380158 6:153818940-153818962 CTTGACCAGCAGATGTTTTGGGG - Intergenic
1017421353 6:154276025-154276047 CATGGCCAGCTAAATTTTTTTGG - Intronic
1017546085 6:155451779-155451801 CACGCCCAGCTAATATTTTTTGG + Intronic
1017934445 6:158992434-158992456 CATGCCCAGCTAATTTTTGTGGG + Intronic
1018014150 6:159696878-159696900 CACACCCAGCTACTGTTTTTTGG - Intronic
1018206278 6:161440105-161440127 CACGCCCGGCTAATTTTTTTTGG + Intronic
1018306780 6:162466101-162466123 CATGCCCAGCTTATTATTTCTGG + Intronic
1019423051 7:960101-960123 CATGCCCAGCTAAGTTTTGTGGG + Intronic
1019584492 7:1790483-1790505 CACGCCCAGCTCATTTTTTGGGG - Intergenic
1019794794 7:3041726-3041748 CACGCCGGGCTAATTTTTTGTGG + Intronic
1020059602 7:5142605-5142627 ACTGCCCAGCTAATTTTTTTGGG + Intergenic
1020134644 7:5580252-5580274 CATGCCCAGCTAATATTTGTGGG - Intergenic
1021684492 7:23170055-23170077 CACGCCCGGCTAATTTTTTTTGG - Intronic
1021729715 7:23584690-23584712 TACGCCCAACTAATTTTTTGGGG + Intergenic
1022221923 7:28322136-28322158 AATGCCCATCTAATGCTTTTGGG - Intronic
1022682847 7:32566331-32566353 CACGCCCAGCTAATTTTTTGTGG + Intronic
1022705013 7:32793995-32794017 CATGCCTGGCTAATTTTTTGGGG + Intergenic
1022732603 7:33044183-33044205 CAAGCCCAGCTAATTTTGTATGG + Intronic
1022865214 7:34411026-34411048 CATGCCTGGCTACTTTTTTGTGG - Intergenic
1022966157 7:35474273-35474295 CATGCCCAGGTAATGAGTAGAGG + Intergenic
1023449859 7:40272017-40272039 TTTGCCCAGCTAATTTTTTATGG + Intronic
1023500081 7:40839397-40839419 CCTGCCCAGCTAATTTTTATTGG + Intronic
1023906235 7:44523572-44523594 CATGCCCAGCTGATATTTGGTGG - Intronic
1024157819 7:46643333-46643355 CACACCCAGCTAATTTTTTGTGG + Intergenic
1024568054 7:50699980-50700002 CACGCCCGGCTAATTTTTTTTGG - Intronic
1024606143 7:51024150-51024172 CACGCCCGGCTAATTTTTTGTGG - Intronic
1024747701 7:52427395-52427417 CACGCCCAGCTAATTTTTGTTGG + Intergenic
1025871168 7:65435505-65435527 CATGCCCGGCTAATTGTTTTTGG - Intergenic
1025922788 7:65929254-65929276 CACACCCAGCTAATTTTTTTTGG - Intronic
1025974070 7:66355746-66355768 CACACCCAGCTAATTTTTTTTGG - Intronic
1026182041 7:68050085-68050107 CATGCCCACTTAATTTTTTGGGG - Intergenic
1026550085 7:71360779-71360801 CATACCCAGCTAATTTTTGTGGG - Intronic
1026656911 7:72264656-72264678 CACACCCAGCTGATTTTTTGTGG + Intronic
1026689024 7:72536421-72536443 CATGCCCAGCTAACTTTTGTAGG - Intergenic
1026945088 7:74310866-74310888 CATGCCCTGCTAATTGTTTTTGG + Intronic
1026996501 7:74620212-74620234 CATGCCTGGCTAATTTTTTTGGG - Intergenic
1027234949 7:76292579-76292601 CATGCCCGGCTAATTTTTGTAGG + Intergenic
1027787586 7:82599500-82599522 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1027873415 7:83739296-83739318 CACGCCCGGCTAATATTTTCTGG - Intergenic
1027991846 7:85372730-85372752 GATACCCAGCTAATATTTTAAGG - Intergenic
1029000875 7:97152804-97152826 CATGCCCAGCAAATTTTTGTAGG + Intronic
1029030154 7:97458622-97458644 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1029481361 7:100815164-100815186 CATGCCCAGCTAATTTTTTTTGG - Intronic
1029589941 7:101500662-101500684 CACGCCCAGCTAATTTTTGTGGG - Intronic
1029591792 7:101511834-101511856 CATGCCCAGCTAATTTTGGGGGG - Intronic
1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG + Intronic
1029715435 7:102322898-102322920 CACGCCTAGCTAATTTTTTTTGG + Intergenic
1029983896 7:104903755-104903777 AATGCCCAGCCAATTTTTTATGG + Intronic
1030071654 7:105703145-105703167 CACGCCCAGCTAATTTTTTGGGG - Intronic
1030224845 7:107138838-107138860 CATGCCCAGCTTATTTTTTTTGG + Intronic
1031586577 7:123537975-123537997 CATTAGCAGCTAATTTTTTGTGG - Exonic
1032182717 7:129694519-129694541 CATGCCTGGCTAATTTTTTTTGG + Intronic
1032201049 7:129823304-129823326 CATGCCCAGGTAATTATTTGGGG - Intergenic
1032234632 7:130109377-130109399 CATGCCTGGCTAATTTTTTTTGG + Intronic
1032277034 7:130466930-130466952 CATGCCTGGCTAATTTTTGGGGG + Intergenic
1032376822 7:131428012-131428034 CATGCCCAGCTAACTTTTTTTGG - Intronic
1033105713 7:138520531-138520553 TTTGCCCAGCTAATTTTTTGTGG - Intronic
1033163931 7:139022387-139022409 CATACTCAGCTAATCTTTTTAGG - Intergenic
1033373767 7:140736891-140736913 CACACCCAGCTAATTTCTTGTGG - Intronic
1033673323 7:143513373-143513395 CATGCCCAGCTAACATGATGGGG + Intergenic
1033714380 7:143984646-143984668 CGCGCCCAGCTAATTTTTAGTGG - Intergenic
1034458206 7:151183243-151183265 CATTCCCAGCTAATTTTTTGTGG - Intronic
1034512841 7:151550323-151550345 CATGCCCAGCTAATTTAATGTGG - Intergenic
1034614014 7:152398981-152399003 CAAGCCCAGCTAATTTTTGTGGG + Intronic
1034894648 7:154868662-154868684 CAGGTCCAGCTAATGCTCTGGGG - Intronic
1035450138 7:158972682-158972704 CACGCCCAGCTAATTTTTTGTGG + Intergenic
1035848639 8:2891777-2891799 CACGCCCAGCTAATTTTTGTAGG + Intergenic
1036008562 8:4694510-4694532 CATGCCAGGCTAATTTTTTTTGG + Intronic
1036144619 8:6243516-6243538 CATACCCAGCTAATTTTCTGTGG - Intergenic
1036164830 8:6422843-6422865 CACGCCCGGCTAATTTTTTGTGG + Intronic
1037647945 8:20810731-20810753 CATGCCCGGCTAATTTTTGTGGG - Intergenic
1037894872 8:22645323-22645345 CACGCCCGGCTAATTTTTGGTGG - Intronic
1037971117 8:23172647-23172669 CACGCCCGGCTAATTTTTTATGG - Intergenic
1038272376 8:26085804-26085826 CATGCCCAGCTAATTTTTGTGGG - Intergenic
1038812231 8:30860276-30860298 CGTGCCCAGCTAATTTTTGTAGG + Intronic
1039060773 8:33570605-33570627 CATGCCTGGCTAATTTTCTGGGG + Intergenic
1039335706 8:36586976-36586998 CATGCCAAGCTATTTTTTGGTGG - Intergenic
1039853400 8:41391780-41391802 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1039865419 8:41496962-41496984 CATGCCCGGCTAATTTTTTTTGG + Intronic
1040030154 8:42816467-42816489 CATGCCTAGCTAATTTTTTTGGG - Intergenic
1040108166 8:43551848-43551870 CATTCCCCACTCATGTTTTGGGG + Intergenic
1040428121 8:47309880-47309902 CATGTCCGGCTAATTTTTTTTGG - Intronic
1040472336 8:47744720-47744742 CATCCCCAGCTAATTTTCTTTGG - Intergenic
1040789628 8:51211091-51211113 CATGCCCGGCTACTTTTTTTTGG - Intergenic
1040917734 8:52580701-52580723 CATGCCCAGCTAATTTTTAGTGG - Intergenic
1041061519 8:54039401-54039423 CACGCCCGGCTAATATTTTGTGG + Intergenic
1041492250 8:58446951-58446973 CATGCCCAGCTAATTTTTTCTGG + Intronic
1042532384 8:69829519-69829541 CGTGCCCAGCTAATTTTTTGTGG - Intronic
1042585145 8:70329109-70329131 CATGCCTGGCTACTGTTTTCTGG + Intronic
1042717506 8:71790546-71790568 CACACCCCGCTAATTTTTTGTGG - Intergenic
1042905194 8:73765501-73765523 CATGCCCAGCTAATTTTTGTGGG + Intronic
1042914772 8:73864731-73864753 CATGTCCAGCAAATTTTTTTGGG + Intronic
1043388506 8:79769518-79769540 CATGCTCAGCTAATTGTTTTTGG + Intergenic
1043525073 8:81087705-81087727 CAAGCCCAGCTAATGTTTCGGGG + Intronic
1044212900 8:89571545-89571567 CACGCCCGGCTAATTTTTGGTGG + Intergenic
1044321858 8:90811102-90811124 CATGCCCGGCTAATTTTTTGGGG + Intronic
1045914782 8:107454922-107454944 CAAGCCCAGGCAATGTTTTGAGG - Intronic
1046477456 8:114765400-114765422 CATGCCCAGCTAATTATTTTTGG - Intergenic
1046534285 8:115488516-115488538 CACGCCCAGCTAATTTTTTGGGG - Intronic
1046755644 8:117970457-117970479 CATGCCTGGCTAATTTTTTTTGG + Intronic
1046899661 8:119510236-119510258 CAAGCCTAGCTAGTGTTTTGAGG + Intergenic
1047223561 8:122938222-122938244 CATGCCCAGTTTATGTTTCCTGG + Intronic
1047395316 8:124492478-124492500 CACACCCAGCCAATTTTTTGGGG - Intronic
1047791622 8:128209519-128209541 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1048338547 8:133521288-133521310 CACACCCAGCTAATTTTTGGGGG + Intronic
1048704531 8:137136788-137136810 CATGCCCAACTATTCTTTTATGG - Intergenic
1048777540 8:137963965-137963987 CACGCCCAGCTAATTTTTTGTGG - Intergenic
1049430507 8:142560994-142561016 CCTGCCCAACTAATTTTTTAAGG + Intergenic
1051423706 9:16913995-16914017 CATGCCAGGCTAATTTTTTGTGG + Intergenic
1051495526 9:17718569-17718591 CATGCCCAGCTAATTTTTGTGGG - Intronic
1051627661 9:19113728-19113750 CATGCCCAGCTAATTTTTGTGGG + Intronic
1051887355 9:21907399-21907421 CATGCCCAGCTAATTTTTGTAGG - Intronic
1051948571 9:22602406-22602428 CATGACCGGCTAATTTTTTTTGG - Intergenic
1052249009 9:26375157-26375179 CATACCCAGCTACTGTTTTTTGG - Intergenic
1052531438 9:29689503-29689525 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1052728011 9:32253251-32253273 CATGCCCGGCTAATTTTTTTTGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053394148 9:37757238-37757260 CATGCTCATCTAATTCTTTGTGG + Intronic
1053444239 9:38139452-38139474 CATGACTAGCTAATTTTTTGTGG + Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053797113 9:41736648-41736670 CATACCCGGCTAATTTTTTTTGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054148084 9:61578220-61578242 CATACCCGGCTAATTTTTTTTGG - Intergenic
1054185527 9:61948729-61948751 CATACCCGGCTAATTTTTTTTGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054467824 9:65509314-65509336 CATACCCGGCTAATTTTTTTTGG - Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054556308 9:66660773-66660795 CACACCCAGCTAATTTTTTTAGG - Intergenic
1054781163 9:69167082-69167104 CACGCCCAGCTAATTTTTCTGGG - Intronic
1054986860 9:71271654-71271676 CAGGCCCAGCGAATCCTTTGTGG - Intronic
1055219499 9:73911196-73911218 CATGCCAAGCTAATTTTTTGGGG - Intergenic
1055305326 9:74923514-74923536 CATGCTCTGCTAATTTTTTAAGG - Intergenic
1056065335 9:82927716-82927738 CATGCCCGGCTAATTTATTATGG - Intergenic
1057109591 9:92455231-92455253 TGTGCTCAGCTAATTTTTTGTGG - Intronic
1057596887 9:96422199-96422221 CATGCCCAGCTAATTGTTTTTGG - Intergenic
1057778852 9:98033807-98033829 CCTGCCCAGATAATGTTTTTTGG - Intergenic
1057918764 9:99078957-99078979 ACTGCCCAGCTGGTGTTTTGGGG + Intergenic
1058138434 9:101333621-101333643 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1058454076 9:105123159-105123181 CACACCCAGCTAATTTTTGGTGG - Intergenic
1058854000 9:109041972-109041994 TATGCCTGGCTAATTTTTTGTGG - Intronic
1058987300 9:110220203-110220225 CACACCCAGCTAATTTTTTGTGG - Intergenic
1059145242 9:111894361-111894383 CGTGCCCAGCCAATGGCTTGTGG - Intergenic
1059298771 9:113296436-113296458 CACGCCCAGCTAATCTTTGCTGG + Intergenic
1060227264 9:121800644-121800666 CATGTCCAGCTAATTTTTCTGGG + Intergenic
1061096852 9:128462754-128462776 CATGCCCGGCTAATTTTTTATGG + Intronic
1061562312 9:131413530-131413552 CACACCCAGCTAATTTTTAGTGG + Intronic
1061616942 9:131786620-131786642 CATGCCTAGCTAATTTTTTGTGG + Intergenic
1185573848 X:1154743-1154765 CACGCCCGGCTGATGTTTTTAGG + Intergenic
1187009749 X:15267255-15267277 CACGCCTGGCTAATTTTTTGGGG - Intronic
1187057820 X:15757549-15757571 CATGCCCGGCTAATTTTTGTGGG - Intronic
1187138263 X:16569442-16569464 CATGCTCAGCTAATTTTTTAAGG - Intergenic
1187287008 X:17915351-17915373 AATGCCCACTTAATGTTTTGTGG - Intergenic
1187407963 X:19021546-19021568 AGTGGCCAGCTAGTGTTTTGGGG - Intronic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1187871765 X:23770645-23770667 CATGCTCAGCTAAATTTTGGTGG + Intergenic
1188536463 X:31202026-31202048 CATGCCTGGCTAATTTTTTGTGG - Intronic
1189151302 X:38710122-38710144 CATGCCTAGCTAATTTTTGTGGG + Intergenic
1189275476 X:39782130-39782152 CAAGCCCAGCTAATGTTTTTTGG + Intergenic
1189349429 X:40265888-40265910 CACGCCCAGCTAAATTTTTTTGG - Intergenic
1189376178 X:40467801-40467823 CATACCCGGCTAATTTTTTTTGG + Intergenic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1190053151 X:47166623-47166645 CATGCCCAACTAATATGTTGTGG + Intronic
1190158819 X:48015862-48015884 CACACCCAGCTAATATTTTCTGG - Intronic
1190170632 X:48109184-48109206 CACCCCCAGCTAATTTTTTTTGG + Intergenic
1190174518 X:48138141-48138163 CACACCCAGCTAATATTTTCTGG - Intergenic
1190502236 X:51090773-51090795 CATGCACAGGTAAGGTTTTTGGG + Intergenic
1190710836 X:53068623-53068645 CATGCCTGGCTAATTTTTTAAGG - Intronic
1190789940 X:53689220-53689242 CATGCCTGGCTAATTTTTTTTGG + Intergenic
1191862026 X:65673609-65673631 CATGCCCAGCTAATTTTGTATGG + Intronic
1192797499 X:74436246-74436268 AATGCGAAGCTAATGTTTGGTGG + Intronic
1193730563 X:85097492-85097514 CATGCCCAGCTAATTTTTTAAGG + Intronic
1193913861 X:87341380-87341402 CATGCCCAGCTAATATTTTTGGG - Intergenic
1195091494 X:101463908-101463930 CATGCCCGGCTAATTTTTTTTGG + Intronic
1195132585 X:101868455-101868477 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1195196401 X:102501535-102501557 CATACCCAGCTAATTTTTTGTGG + Intergenic
1196789793 X:119453688-119453710 CACACCTAGCTAATTTTTTGGGG + Exonic
1196908263 X:120460114-120460136 CAAGCCCAGCAAATTTTTAGTGG - Intronic
1197780747 X:130157792-130157814 CCTGCCCAGCTAATTTTTAACGG - Intronic
1197859579 X:130956238-130956260 CACGCCCGGCTAATTTTTTGTGG - Intergenic
1197932476 X:131710122-131710144 CGTGCCCAGCTAATTTTGTGGGG + Intergenic
1198462457 X:136876862-136876884 CACACCCAGCTAATTTTTGGTGG + Intronic
1198751460 X:139940260-139940282 CATGCCCGGCTAATTTTTGTAGG - Intronic
1199225000 X:145363058-145363080 CACGCCCAACTAATTTTTTGTGG + Intergenic
1199756278 X:150867923-150867945 CACGCCCAGCTAATTTTTGTAGG - Intronic
1200780546 Y:7211536-7211558 CAGGCCTGGCTAATTTTTTGTGG - Intergenic
1201055488 Y:9985979-9986001 CACGCCCGGCTAATTTTTTTTGG + Intergenic
1201587924 Y:15581786-15581808 CATGCCCAGCTAATTTTTTTAGG + Intergenic
1201738296 Y:17295686-17295708 CAAATCCTGCTAATGTTTTGGGG + Intergenic
1201904545 Y:19076332-19076354 CATGCCTAGCTAAATTTTTTTGG - Intergenic