ID: 1001601207

View in Genome Browser
Species Human (GRCh38)
Location 5:172929889-172929911
Sequence AGTTCTTAGAAAAAGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001601205_1001601207 1 Left 1001601205 5:172929865-172929887 CCTGAAAAGTTGATCATGATGTT 0: 1
1: 1
2: 0
3: 14
4: 196
Right 1001601207 5:172929889-172929911 AGTTCTTAGAAAAAGATGGCTGG 0: 1
1: 1
2: 0
3: 27
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001601207 Original CRISPR AGTTCTTAGAAAAAGATGGC TGG Intronic
901868699 1:12124899-12124921 AGCTCTTAGGGAAAGATGCCAGG + Intronic
903006174 1:20300404-20300426 TGTTGTTAGATAAAGATGCCAGG + Intronic
905165924 1:36083398-36083420 AGTACATAGAAAAAGTAGGCTGG - Intergenic
905707749 1:40074763-40074785 AATACTTAGAAAAAACTGGCCGG - Intronic
906094791 1:43215322-43215344 AGGTCTTTGATAAGGATGGCCGG + Intronic
906490721 1:46266476-46266498 AGTTCTTGGAGAAAGAGGGAAGG + Intronic
908823254 1:68109434-68109456 AGTTCTTAGAAGTAGAAGTCTGG - Intronic
909115844 1:71535299-71535321 AGTTCATTGAAAAAGACGGGTGG + Intronic
910537336 1:88313491-88313513 AATCCATAGAGAAAGATGGCAGG + Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910854379 1:91680140-91680162 TCTTCTCAGAAAAACATGGCAGG - Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911478238 1:98400953-98400975 AGTTCTTATAAAAAGGATGCAGG + Intergenic
911631467 1:100188327-100188349 ATTTCTTAGAAAAATGTAGCTGG - Exonic
912456810 1:109803556-109803578 AGGTCTTGGAAAAGGATTGCAGG - Intergenic
913135133 1:115880866-115880888 AGATGGTAGAAAGAGATGGCTGG + Intergenic
913591269 1:120328861-120328883 AGCCGTTAGAAAAAGGTGGCTGG - Intergenic
913652096 1:120926238-120926260 AGCCATTAGAAAAAGGTGGCTGG + Intergenic
914169011 1:145202832-145202854 AGCCGTTAGAAAAAGGTGGCTGG - Intergenic
914524132 1:148446787-148446809 AGCCGTTAGAAAAAGGTGGCTGG - Intergenic
914599544 1:149189084-149189106 AGCCGTTAGAAAAAGGTGGCTGG + Intergenic
914642274 1:149620349-149620371 AGCCGTTAGAAAAAGGTGGCTGG + Intergenic
914846384 1:151286011-151286033 AGTTCTTAGAAATACAGGGAAGG - Exonic
914875514 1:151510809-151510831 ATTACATAGAAAAAGATGTCAGG + Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917156584 1:172006388-172006410 AGTTTTTACAAGAAGAAGGCAGG - Intronic
917698879 1:177559963-177559985 AATTTTTAAAAAAAGATGGATGG + Intergenic
918599079 1:186331876-186331898 TAATCTTAGAAAAAGATAGCAGG + Intronic
919889018 1:201956663-201956685 AGATCTTAGAAAAATAAGGCCGG + Intronic
920025353 1:202990053-202990075 TTTTCTTAAGAAAAGATGGCTGG - Intergenic
920562070 1:206946105-206946127 ATTTCTCAGAAAAGGATGGGGGG + Intronic
923360479 1:233206174-233206196 AGATCCCAGGAAAAGATGGCTGG + Intronic
923647344 1:235837330-235837352 AATTCTGAGAGAAAGCTGGCGGG + Intronic
924057799 1:240141205-240141227 AGATCTTTGAAAAAGATGTCAGG + Intronic
1063547247 10:6993203-6993225 AGGTCTTAGAAATAATTGGCTGG + Intergenic
1063548621 10:7006836-7006858 AGCTCTTAGAAAATGAAAGCTGG - Intergenic
1063714838 10:8516297-8516319 AGTTCTTAAAAAAAGGAGGCGGG + Intergenic
1064313755 10:14235820-14235842 AGCACTTAGAAAATCATGGCAGG - Intronic
1064598897 10:16973475-16973497 GGTTTTTAGAAAAAGAAGTCAGG - Intronic
1065079819 10:22117277-22117299 AGTTCTAAGAAAAACATAGCAGG - Intergenic
1065996243 10:31062003-31062025 AGTTGTTAGACAAATTTGGCCGG - Intergenic
1066814870 10:39393943-39393965 AGATTTTAGAAAAAGACTGCTGG - Intergenic
1067654782 10:48183169-48183191 AGTACCTAGAAAATGCTGGCTGG + Intronic
1068021741 10:51594025-51594047 AATTCTTAAAAAAAAATGGGGGG - Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1070342113 10:75507222-75507244 ACTGCTTGGAGAAAGATGGCTGG + Intronic
1072020958 10:91400996-91401018 TGTTCTTTGACAAAGATGCCAGG + Intergenic
1073853424 10:107647561-107647583 AGTACTGAGGAATAGATGGCAGG - Intergenic
1074246962 10:111703940-111703962 AGTTCATACATAAAGGTGGCAGG - Intergenic
1074410917 10:113227743-113227765 AGTTGTTAGATTTAGATGGCTGG + Intergenic
1074592313 10:114824244-114824266 AGTACTTAGAAAAAGAAAGACGG + Intronic
1074723782 10:116286654-116286676 CTTTCTTAGAGAAAAATGGCGGG + Intergenic
1075626259 10:123966326-123966348 ATTAATTACAAAAAGATGGCGGG - Intergenic
1076272718 10:129168736-129168758 AGTTCTTAGACAAACATTCCTGG - Intergenic
1080077952 11:28174502-28174524 AGATCTTAAAAAAATATGTCTGG - Intronic
1081002997 11:37697315-37697337 AGTTCTTAGCTAAAGAAGCCAGG - Intergenic
1081168191 11:39832798-39832820 AATTATTAGTAAAATATGGCTGG + Intergenic
1081282998 11:41233877-41233899 AGTTCTTAGATTAAGGGGGCAGG + Intronic
1082801320 11:57416850-57416872 AGATCTTAGAAAAGGAAGCCTGG - Intronic
1083762838 11:64827996-64828018 AGTTGTTAGAAAATTAAGGCAGG - Intronic
1084346186 11:68550792-68550814 AGTTCTTAAGAAGAGAGGGCTGG - Intronic
1084478925 11:69405868-69405890 ATTTCTTTAAAGAAGATGGCCGG - Intergenic
1087398037 11:97627401-97627423 AGTTCTTGGGAAAAGATGGATGG + Intergenic
1087764123 11:102131255-102131277 AGTTCACAGAAAAGAATGGCAGG - Intronic
1088668161 11:112115424-112115446 CGCTCATAGAAAAAGATGTCTGG + Intronic
1089450646 11:118593539-118593561 GAATATTAGAAAAAGATGGCTGG - Intronic
1089913093 11:122123436-122123458 AGTTATTAGGAAAACATAGCAGG - Intergenic
1090514313 11:127409407-127409429 ATTTTCTAGAAAACGATGGCTGG - Intergenic
1092938986 12:13390167-13390189 AGTTTTTAGAAGAAGATAGAGGG + Intergenic
1093220581 12:16415795-16415817 AGATCTTTGAAAAACATGGGCGG - Intronic
1093294624 12:17373385-17373407 AATTCTTAGAAAAAAATTACAGG - Intergenic
1096882651 12:54685352-54685374 AGGTCATAGAAAAAGTGGGCTGG - Intergenic
1099015146 12:77335605-77335627 ACTTCTTAGATGAAGATGCCTGG - Intergenic
1099228760 12:79999469-79999491 AGTTCCCAGAGAAATATGGCAGG - Intergenic
1099885767 12:88528263-88528285 AGTTCTTATAAAAGGGAGGCAGG - Intronic
1100199959 12:92287811-92287833 ATTACTTAGAAAAACAAGGCTGG - Intergenic
1101863527 12:108502145-108502167 AGTTGTAAGATAAAGATGGAGGG + Intergenic
1101937512 12:109070123-109070145 ACTTGTTAGAAAAGGAAGGCTGG + Intronic
1103161711 12:118734703-118734725 ATTTCCTATAGAAAGATGGCAGG - Intergenic
1104070301 12:125338988-125339010 AATACGTAGAAAAATATGGCAGG + Intronic
1104356813 12:128094157-128094179 AGTTAATAGAAAAAAATTGCAGG - Intergenic
1104468559 12:129009487-129009509 GGTTCTTAGTAAAACATGGTGGG + Intergenic
1105618102 13:22039761-22039783 AGTTAAAAGATAAAGATGGCCGG - Intergenic
1106305117 13:28502841-28502863 ATTTATTTGAAAATGATGGCTGG + Intergenic
1106322507 13:28655193-28655215 AGCTGTTAGAAAAAGGAGGCAGG - Intergenic
1106368911 13:29112340-29112362 GGTTCCTGGAAAGAGATGGCTGG + Intronic
1107051988 13:36060685-36060707 AGTTAATAAAAAAAGATGTCTGG + Intronic
1107461938 13:40612527-40612549 ATTTCTTTCAAAAAGAAGGCTGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109192580 13:59343246-59343268 AGTTCTGAGCAAAAGAAGGGGGG + Intergenic
1111293661 13:86201795-86201817 AGTTCTTATAAACAAATGGTTGG + Intergenic
1113635724 13:111917834-111917856 TTTTCTTAGAATAAGATGGAGGG + Intergenic
1115196199 14:30802549-30802571 ATTTCTTAGTATAAGATGTCTGG + Intergenic
1115687964 14:35816478-35816500 AGCTCTTATAAAAAGATCACTGG - Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116644819 14:47513872-47513894 AGTTCTTACACAAAGAGGGAAGG - Intronic
1117120393 14:52561829-52561851 AGGACTTACAAAAAGAGGGCAGG + Intronic
1117359401 14:54958429-54958451 AGTTCTTGGAAAAATTTGGCTGG - Intronic
1117732421 14:58736731-58736753 ATTACTTAGAAAATGATGGGTGG + Intergenic
1119201954 14:72760386-72760408 GGTTCTTATAAAAGGAAGGCAGG - Intronic
1119649937 14:76376358-76376380 AGTTGGTAGAGAAAGACGGCGGG - Intronic
1119878410 14:78079840-78079862 ATTTCTGCAAAAAAGATGGCTGG + Intergenic
1120479145 14:85026511-85026533 GATTATTAGAAAAAGATGGAAGG + Intergenic
1121497762 14:94408162-94408184 AGTTTTTAGAAAATGTTGGCTGG + Intergenic
1122392210 14:101397554-101397576 AGTTTGTGGAAAAAGCTGGCTGG - Intergenic
1127514487 15:59678739-59678761 AGTCCTTACCAAAAGATGGGGGG + Intronic
1128754634 15:70173176-70173198 AGGACTTAGAAGGAGATGGCAGG - Intergenic
1129585101 15:76854661-76854683 AGTTTTAAAAAAAACATGGCCGG + Intronic
1129835986 15:78706037-78706059 AGTCCTGAGAAGAAGATGGAAGG + Intronic
1130394786 15:83492664-83492686 AGTGCTTAGCCAAAGATGGGTGG + Intronic
1133759516 16:8787137-8787159 GGTTCTTGGAAATGGATGGCAGG + Intronic
1134341499 16:13350960-13350982 ACTTCCTAGAAAAAGCTTGCAGG + Intergenic
1134478418 16:14596245-14596267 AGTGCTCAGAAAAGGATGGGGGG + Intronic
1135109414 16:19679114-19679136 AGCTGTTAGCAAAAGAAGGCTGG + Intronic
1139653189 16:68372784-68372806 AGTTTTTAGAATGAGAGGGCAGG + Intronic
1140230564 16:73114090-73114112 ATCTCTTAAAAAAAAATGGCCGG - Intergenic
1140465569 16:75179245-75179267 ATTTCTTAGAAAAAGACAACAGG + Intergenic
1141108048 16:81249776-81249798 AGGTCTAAGAGAAAGATGGAGGG - Intronic
1141479789 16:84298873-84298895 AGGTCTTAGAGATAGAAGGCGGG - Intronic
1146188902 17:30747749-30747771 GTCTCTTAGAAAAAGAAGGCTGG - Intergenic
1146333789 17:31952068-31952090 GTCTCTTAGAAAAAGAAGGCTGG - Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1148766597 17:50043086-50043108 TGTTCTTAGAAAAAAATGTCAGG - Intergenic
1149456572 17:56793103-56793125 AGTGCTCAGAAAATGATAGCTGG - Intronic
1150354302 17:64470043-64470065 AGTTCTGGAAAAAAGATGGAAGG + Intergenic
1150720403 17:67609588-67609610 AGTGCTTAGAAGAACATGACTGG - Intronic
1153039796 18:801559-801581 AGTTAGTAGAAATAGATGGAAGG - Intronic
1153821116 18:8832806-8832828 AGTCCTTAGGAAAAGATGGAGGG - Intergenic
1155141197 18:23046295-23046317 AGTTCTTACAAAGAGATGAGTGG - Intergenic
1158199316 18:54922528-54922550 AGTTACTAGGAAAAGATGACTGG + Intronic
1158453233 18:57585670-57585692 ACGTCTTAGAAAAATATGTCCGG + Intronic
1158851613 18:61500471-61500493 AGTCCACAGAAAAATATGGCTGG - Exonic
1159465539 18:68778276-68778298 AAATCTTAGAAAAAGATGGATGG - Intronic
1160465307 18:79071668-79071690 AGTGCTAAGAAAAGAATGGCAGG - Intronic
1161644209 19:5443353-5443375 AGTGCTTAGAAGAATTTGGCTGG - Intergenic
1163075440 19:14886879-14886901 AGTTCACAGAAAAAAATGGGGGG + Intergenic
1163403616 19:17109359-17109381 TCTTATTAGAAAATGATGGCCGG - Intronic
1165352764 19:35285104-35285126 AGGTCTTGGAATAAAATGGCTGG + Exonic
1166434238 19:42754174-42754196 AGTTCTTAGACAAATTTGGAGGG + Intronic
1166447092 19:42867942-42867964 AGTTCTTAGACAAATTTGGAGGG + Exonic
1166454017 19:42925614-42925636 AGTTCTTAGACAAATTTGGAGGG + Intronic
926748656 2:16180996-16181018 AGTCCTTAGAAAGAGAAGGCAGG - Intergenic
929526603 2:42709328-42709350 AGTGCTTAGCAAAAGATTGGTGG + Intronic
930167754 2:48219956-48219978 AGATGTCAGAAAAAGAGGGCAGG + Intergenic
930384170 2:50672525-50672547 AGGTCTTAGAACAACAAGGCTGG + Intronic
930780001 2:55215389-55215411 AGCTATTATAAAAAGATGGAAGG - Intronic
930813931 2:55572412-55572434 AGCTCTAAGAAAAAGATAACTGG + Intronic
931350748 2:61486115-61486137 AGTTTTTAGCAAAAGAAAGCAGG + Intronic
932761848 2:74442941-74442963 ACGTCTAAAAAAAAGATGGCTGG + Intergenic
932822144 2:74910796-74910818 ATTTCATAGAACAGGATGGCAGG - Intergenic
933690255 2:85174182-85174204 AGAACATAGAAAAAGAAGGCCGG - Intronic
934780577 2:96967232-96967254 AATTCTTAGAAACAGATCTCGGG - Intronic
935220910 2:101011537-101011559 AGTGCTTAAAAAAAGATGAGAGG + Exonic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935559373 2:104544733-104544755 ACTTATGAGAAAAAGCTGGCTGG + Intergenic
935914612 2:107935745-107935767 AGTTCTTTAAAAGAGAGGGCTGG + Intergenic
937014975 2:118596895-118596917 ACGTCTTAGACACAGATGGCTGG - Intergenic
939567239 2:143799374-143799396 GGTTGTAAGAAAAAGATGACTGG - Intergenic
939762537 2:146200491-146200513 AAATCTTAAAAAAAGGTGGCTGG + Intergenic
940084945 2:149848676-149848698 AGTTTTGGGAAAGAGATGGCAGG + Intergenic
940206087 2:151203220-151203242 AGTTCAGAGAAGAGGATGGCTGG + Intergenic
941702752 2:168621887-168621909 AATGCTTAGAAAAGGATGGTTGG + Intronic
943912429 2:193585473-193585495 AGATTTTAGAACTAGATGGCAGG + Intergenic
944631469 2:201630275-201630297 ATTTCTTAGGAAAAGATGTCAGG + Intronic
944873441 2:203937171-203937193 TGTTCTTAGAGAAAGATGAAAGG + Intronic
946344089 2:219094256-219094278 AGATCCCAGAAAAAGATGGAGGG + Intronic
947125486 2:226864209-226864231 ATTTCTTTGAAAAAAATGGAGGG + Intronic
947957569 2:234206704-234206726 AGTTCTTAAAAGAATATGGTGGG - Intergenic
948473509 2:238202423-238202445 AGCTCTTAGAAAGCGAAGGCTGG + Intronic
1168911323 20:1449535-1449557 AGTTCTCAGGAAGAGCTGGCAGG - Intronic
1172633472 20:36394004-36394026 GGTTCTGAGAAATAGAAGGCAGG - Intronic
1174525933 20:51171213-51171235 AGTTCTGAGAAAGATAAGGCTGG + Intergenic
1174578266 20:51553074-51553096 ACTTCTTAAAAAAAAAAGGCAGG + Intronic
1175048427 20:56129277-56129299 AGTTTGTCCAAAAAGATGGCAGG - Intergenic
1175400177 20:58695847-58695869 AGTCCTTAGAAAACAATGTCAGG - Intronic
1177067347 21:16456384-16456406 AGTACTTAAAAAATGATGCCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179462650 21:41548155-41548177 ATTTCTTAGTAAAAGTTTGCAGG + Intergenic
1181076791 22:20383907-20383929 AGTTTTATGAAAAAGATGGAAGG - Intronic
1182892629 22:33831628-33831650 AGTTTTTAAAAAAAGATAACTGG + Intronic
1183808361 22:40232714-40232736 AGTTTTTAAAAATAGCTGGCTGG + Intronic
1184781564 22:46652215-46652237 GGTTCTGAGAAGGAGATGGCAGG + Intronic
1184805228 22:46791032-46791054 AGTGATTACAAAAAAATGGCCGG - Intronic
1185004491 22:48267774-48267796 CGTTCTAGGAAAAGGATGGCAGG - Intergenic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
950694582 3:14688726-14688748 AGCTCTTATATGAAGATGGCAGG - Intronic
952828261 3:37541867-37541889 AGTGCTCAGTAAACGATGGCGGG + Intronic
953358830 3:42277432-42277454 AGCTCTTAGAACAAAAAGGCTGG + Intergenic
953506459 3:43490579-43490601 AGACCATAGAAAAAGATGGAAGG + Intronic
954975579 3:54691110-54691132 AGTTCTTAGGAGAAGAGGCCTGG + Intronic
956630727 3:71314228-71314250 AGTTCTTAAAAATAGCTGGCTGG + Intronic
956721377 3:72120831-72120853 AGTTCATACAAGAAAATGGCAGG - Intergenic
958984772 3:100767550-100767572 ATTTGTTAGAAAAAGATGGAAGG + Intronic
959524725 3:107363945-107363967 AGTTCTGAGAAAGAGGTGGATGG + Intergenic
961813746 3:129536813-129536835 ATTTCTCAGAAAAAGTGGGCTGG - Intergenic
962229016 3:133644019-133644041 AGTTGTTACAAATACATGGCTGG - Exonic
962588573 3:136865954-136865976 AGTTCAAAGATAAAAATGGCTGG - Intronic
963206372 3:142639769-142639791 AGTTCTTAGTAAGTGTTGGCTGG + Intronic
964610958 3:158614437-158614459 AGTTCATAGAAAAAAATTACAGG - Intergenic
964680261 3:159330754-159330776 AGTTCTTTTAAAAAGTTGTCTGG - Intronic
967205784 3:187119701-187119723 GGCTGTTAGACAAAGATGGCTGG - Intergenic
969250229 4:5962940-5962962 AGTACTTGTAAAAAGATGGGAGG - Intronic
970831461 4:20345234-20345256 AGTACTCAGAAAATAATGGCAGG + Intronic
971787788 4:31126938-31126960 AGTTCTTAGGCAAAGAAGACTGG - Intronic
972191336 4:36594737-36594759 AGTGCTTAGAAAAAAATGACTGG + Intergenic
972469142 4:39386807-39386829 AGTACTTAGAAAAAAATATCTGG - Intergenic
973088318 4:46097899-46097921 AGTTCTTGGAAAAAGATGGCTGG - Intronic
974592908 4:63977492-63977514 AATTCTTAGAAAAACATGCCAGG - Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976239206 4:82935582-82935604 GCTTCTTAGAAATATATGGCCGG - Intronic
978495440 4:109354820-109354842 AGCTGTGAGAAAAAGGTGGCTGG - Intergenic
978644249 4:110910097-110910119 TGTTCTCTGAAAAATATGGCAGG - Intergenic
980982438 4:139666005-139666027 AGTTCCGTGAGAAAGATGGCCGG + Exonic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981729142 4:147879068-147879090 AGTTCTAAGAAGAAGAGGGGAGG - Intronic
982038115 4:151366990-151367012 AGTTTTCAAAAAAAGATGGCAGG + Intergenic
982530014 4:156528676-156528698 AAGTATTAGAAAAAGATGGATGG + Intergenic
983814062 4:172100977-172100999 TGTTTTTAGCAAAAGCTGGCTGG - Intronic
984752515 4:183291816-183291838 AGTTCTTTGAAAAAAATGAAAGG + Intronic
986896598 5:12378231-12378253 AATTCTTAGAAGTAGATTGCTGG + Intergenic
987482803 5:18480028-18480050 AGTTCTTAGAAATATGTGGAAGG + Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988072635 5:26313829-26313851 AGATCTTTGAAAAAGATTGTAGG + Intergenic
988109254 5:26795755-26795777 AGTTCTTATAAAATGAAAGCTGG - Intergenic
988346745 5:30046862-30046884 TGTTCTTATAAAAGGATGGGAGG + Intergenic
988410841 5:30884052-30884074 AGTCCTTAGAAACAGTTGGCAGG - Intergenic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
989984359 5:50679992-50680014 AGCCGTTAGAAAAAGGTGGCTGG + Intronic
990881077 5:60540033-60540055 AGGTCTCAGATAAAGCTGGCAGG - Intergenic
991982156 5:72243478-72243500 AGTACTTAAAAAAAGAGGGCAGG + Intronic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
993191754 5:84692091-84692113 AGTTCTAAGAAAAAGGAAGCAGG + Intergenic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993534821 5:89069861-89069883 AGTTCAGAGAAAAAGAGTGCAGG + Intergenic
994478925 5:100308332-100308354 GGTTCTTAGCAAATGATAGCTGG - Intergenic
995079400 5:108030802-108030824 AGGTGTTTGAAAGAGATGGCAGG + Intronic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996594798 5:125187962-125187984 AGTTTTTGGCAAAAGATGACTGG + Intergenic
999963176 5:156778903-156778925 AGTTCTTAGAAAAACGTAGCAGG + Intergenic
1001156438 5:169276373-169276395 AGCTCTTGGAAGAAGATGGGAGG - Intronic
1001601207 5:172929889-172929911 AGTTCTTAGAAAAAGATGGCTGG + Intronic
1001740594 5:174049990-174050012 AGTTCTTAGCCAAAGCAGGCTGG - Intronic
1003752027 6:9069683-9069705 AGGTCTTTGACAAGGATGGCAGG - Intergenic
1004213651 6:13680439-13680461 AGCTCATAAAAAAACATGGCTGG + Intronic
1005657441 6:27955752-27955774 AGTTCTCAGTATAAAATGGCAGG - Intergenic
1005890145 6:30130642-30130664 AGTTCTCAGAAAAACAGGGTTGG - Intergenic
1008139817 6:47819092-47819114 AGTTCGTACAAAAAGGAGGCAGG + Intronic
1008857235 6:56104371-56104393 TGTTCTTAGGTAAAGATGACTGG - Intronic
1010899283 6:81406066-81406088 AGTCTTTTGAAAAATATGGCAGG + Intergenic
1011033961 6:82953332-82953354 AGCCCTTAGAAAGAGCTGGCAGG - Intronic
1012274985 6:97262342-97262364 TGTTATTAAAAAAAGATAGCAGG + Intronic
1012704773 6:102509641-102509663 ATTTGCTAGAAAAAGTTGGCCGG + Intergenic
1012946566 6:105472563-105472585 TGTTTATAGAAAAAGATTGCAGG - Intergenic
1013031390 6:106336648-106336670 AGTTTTTATAAAAATAGGGCAGG - Intergenic
1013605902 6:111747738-111747760 TGTCCTTAAAAAAAGCTGGCAGG + Intronic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014524114 6:122480677-122480699 AATTCTTAGAAATATAAGGCAGG - Intronic
1015284095 6:131465094-131465116 AGCTCTTAGCAAACTATGGCAGG + Intergenic
1015433870 6:133162770-133162792 AGTTTTTAAAAATAGCTGGCTGG - Intergenic
1015779093 6:136845178-136845200 CTTTCTTAGAAAAAGCTTGCAGG - Intronic
1016103637 6:140134415-140134437 ATTTCACAGAAAAAGTTGGCAGG - Intergenic
1017290074 6:152726098-152726120 AGTTCAAAGAAAGTGATGGCCGG + Intergenic
1017703976 6:157103470-157103492 ACTTCATAGAACAAGATGGTGGG - Intronic
1017715732 6:157211729-157211751 AGTTCTTAAAAATAAATAGCTGG - Intergenic
1018415419 6:163598002-163598024 CTTTCTTACAAACAGATGGCTGG - Intergenic
1018493685 6:164325066-164325088 GAGTCTTAGAAAAGGATGGCTGG - Intergenic
1020597623 7:10228612-10228634 AGTTGTCAGAAAAAGATTGTTGG + Intergenic
1021056132 7:16048443-16048465 AGTTCTAAGAAAAGGATAGGTGG + Intergenic
1021188145 7:17589392-17589414 AGCTGTTGGAAAAACATGGCAGG + Intergenic
1021796649 7:24262138-24262160 ACTTCTTAGAAAAACTTTGCTGG + Intergenic
1022020125 7:26391317-26391339 ATTTCTTTAAAAAAGTTGGCTGG - Intergenic
1022067325 7:26872561-26872583 CGTTCATGGAAAAAGATGGGTGG - Intronic
1022227349 7:28376880-28376902 TCTTCTTAGAAAAGGTTGGCTGG + Intronic
1023272990 7:38486537-38486559 AGCTCTTCCAAAAAGATTGCAGG + Intronic
1023344362 7:39256262-39256284 AGTGCTTAGAACAAGAAGGGTGG + Intronic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1025922768 7:65929110-65929132 AGTTTTTGAAAAAAGAGGGCTGG + Intronic
1026626369 7:71995975-71995997 TTTTCTTAGGCAAAGATGGCAGG - Intronic
1027359997 7:77398607-77398629 AGTTTTTAAAAAAATATGCCAGG + Intronic
1027392881 7:77723260-77723282 AGTTCTTAAGAAATGTTGGCCGG - Intronic
1030983782 7:116216163-116216185 AGTTCTCAGAAAAAGAACACAGG - Intronic
1031744538 7:125477634-125477656 AGCTCTTAGTAAAACATGGTAGG + Intergenic
1032731623 7:134648429-134648451 AGTTCAAAAAAAAAGAAGGCCGG - Intronic
1033823664 7:145163385-145163407 CGTTCGTAGAAAAAGCTGGCAGG - Intergenic
1034748205 7:153543077-153543099 AGTGGTTAGAAAAAAATGGTTGG + Intergenic
1035146817 7:156826641-156826663 AGTTCTGAGGAAAAGAAAGCAGG + Exonic
1035939395 8:3879684-3879706 AGTTCTCAGAAAAAAATGAAAGG + Intronic
1036581050 8:10076408-10076430 AGTTCTCCCAAAAAGAAGGCTGG - Intronic
1038242622 8:25823887-25823909 AGTTCTTAGAGAAGCATGGTTGG + Intergenic
1039540084 8:38359534-38359556 AGTTCTTAGAACCAGGTGGTTGG - Intronic
1042029265 8:64457026-64457048 TGTCCTTATAAGAAGATGGCTGG - Intergenic
1044002397 8:86899856-86899878 AGTCCTTCCACAAAGATGGCTGG + Intronic
1044071285 8:87763310-87763332 AATCCTTAGAACAATATGGCAGG + Intergenic
1044462216 8:92458654-92458676 TGTTCTTAGAAAAAGAGATCAGG + Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047087704 8:121537244-121537266 GGTTCTTATAAAAGGAAGGCTGG + Intergenic
1047912446 8:129545059-129545081 AAATTTTAGAAAAAGAAGGCCGG + Intergenic
1047986793 8:130243672-130243694 AGTTTTAAGAAAAAGATTTCAGG - Intronic
1049328291 8:142035595-142035617 AGTTCTCAGAATAAGATGTTTGG - Intergenic
1050395800 9:5194813-5194835 AGTTGTAAGAGAAAGATGCCTGG - Intergenic
1051137908 9:13944027-13944049 ATCTCTTGGAAACAGATGGCAGG + Intergenic
1052047335 9:23809969-23809991 TGTTCTGAGAAAAAAATGGCAGG - Intronic
1052298883 9:26931083-26931105 AGGTCTTATAAAAAGGTGACAGG + Intronic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1055240831 9:74183700-74183722 AGTTCTCAGCAGAAGAGGGCAGG - Intergenic
1055352247 9:75401848-75401870 AGATTTTAGAAATGGATGGCAGG + Intergenic
1055756329 9:79562220-79562242 AGTTGTTAGAGAAGGATTGCTGG + Intergenic
1056171734 9:83992006-83992028 ATTTTTTATAAAAAGATTGCTGG + Intronic
1056199366 9:84259654-84259676 AACTCTTGGAAAAAGGTGGCGGG - Intergenic
1056346605 9:85702733-85702755 AGCTCCTATAAAAAGATGGGAGG + Intronic
1057191494 9:93090509-93090531 AATTCATAGAAACAGAAGGCTGG - Intergenic
1060229856 9:121818590-121818612 AGTTCTTGGAAGTAGATGGAAGG + Intergenic
1185929484 X:4186282-4186304 GGTTCTTTGAAAAAGAGTGCAGG + Intergenic
1187345798 X:18462562-18462584 AGTTATGAGAACAAGAAGGCAGG + Intronic
1188947153 X:36319447-36319469 AGTTGATAGAAAAACATGGATGG + Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189182757 X:39019012-39019034 GGCTCTTGGAAAAAGAGGGCAGG + Intergenic
1191755538 X:64588527-64588549 GGTCCTTATAAAAAGAAGGCAGG - Intergenic
1191844435 X:65536070-65536092 ATATCTTAGGAAAAGTTGGCTGG - Intergenic
1192487713 X:71544460-71544482 AGTTGATAGAATAAAATGGCAGG + Intronic
1192927756 X:75774565-75774587 AGATCTCAGAAAAATATAGCTGG - Intergenic
1193910452 X:87299909-87299931 AGTACATAGAAAATAATGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1195990403 X:110676857-110676879 AGTTTTTAACAAAAGATAGCAGG - Intronic
1197292882 X:124681812-124681834 AGTACCTAGAAAAAAATGCCTGG + Intronic
1198203016 X:134440994-134441016 AATTATTAGAAAAAGGTGTCAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200842931 Y:7802127-7802149 ACTGATAAGAAAAAGATGGCAGG + Intergenic
1200920618 Y:8609781-8609803 AGGTGCAAGAAAAAGATGGCTGG - Intergenic
1202177213 Y:22108819-22108841 AGTTGTCAGCAAAAGATGGCCGG + Intergenic
1202179643 Y:22128626-22128648 AGGTGTGAGCAAAAGATGGCTGG + Intergenic
1202211718 Y:22457768-22457790 AGGTGTGAGCAAAAGATGGCTGG - Intergenic
1202214148 Y:22477565-22477587 AGTTGTCAGCAAAAGATGGCCGG - Intergenic