ID: 1001604536

View in Genome Browser
Species Human (GRCh38)
Location 5:172950608-172950630
Sequence ATGAGATGATGGGCTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2732
Summary {0: 1, 1: 0, 2: 2, 3: 138, 4: 2591}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001604536_1001604543 -10 Left 1001604536 5:172950608-172950630 CCTTGCAGAGCCCATCATCTCAT 0: 1
1: 0
2: 2
3: 138
4: 2591
Right 1001604543 5:172950621-172950643 ATCATCTCATGATGTGGGAGGGG 0: 1
1: 0
2: 0
3: 9
4: 188
1001604536_1001604544 -5 Left 1001604536 5:172950608-172950630 CCTTGCAGAGCCCATCATCTCAT 0: 1
1: 0
2: 2
3: 138
4: 2591
Right 1001604544 5:172950626-172950648 CTCATGATGTGGGAGGGGTCTGG 0: 1
1: 0
2: 6
3: 135
4: 1376
1001604536_1001604545 0 Left 1001604536 5:172950608-172950630 CCTTGCAGAGCCCATCATCTCAT 0: 1
1: 0
2: 2
3: 138
4: 2591
Right 1001604545 5:172950631-172950653 GATGTGGGAGGGGTCTGGCCTGG 0: 1
1: 0
2: 5
3: 35
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001604536 Original CRISPR ATGAGATGATGGGCTCTGCA AGG (reversed) Intronic
Too many off-targets to display for this crispr